ID: 1149238389

View in Genome Browser
Species Human (GRCh38)
Location 17:54619093-54619115
Sequence AAACTACAGCCTGCAAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149238387_1149238389 18 Left 1149238387 17:54619052-54619074 CCAAAACAACATTGCAAAGACTA No data
Right 1149238389 17:54619093-54619115 AAACTACAGCCTGCAAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149238389 Original CRISPR AAACTACAGCCTGCAAAGGT AGG Intergenic
No off target data available for this crispr