ID: 1149238869

View in Genome Browser
Species Human (GRCh38)
Location 17:54625039-54625061
Sequence CAGCTGGGTGTTTCTGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149238869_1149238874 -3 Left 1149238869 17:54625039-54625061 CCCAAGCCAGAAACACCCAGCTG No data
Right 1149238874 17:54625059-54625081 CTGAGCTTTGCCTAAATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149238869 Original CRISPR CAGCTGGGTGTTTCTGGCTT GGG (reversed) Intergenic
No off target data available for this crispr