ID: 1149239750

View in Genome Browser
Species Human (GRCh38)
Location 17:54635398-54635420
Sequence ACTAGGTAGGGCTTGGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149239750_1149239760 17 Left 1149239750 17:54635398-54635420 CCTGAGGCCAAGCCCTACCTAGT No data
Right 1149239760 17:54635438-54635460 AGGCACACCCTGGGCCAAAAGGG No data
1149239750_1149239757 7 Left 1149239750 17:54635398-54635420 CCTGAGGCCAAGCCCTACCTAGT No data
Right 1149239757 17:54635428-54635450 TGACATTTCTAGGCACACCCTGG No data
1149239750_1149239758 8 Left 1149239750 17:54635398-54635420 CCTGAGGCCAAGCCCTACCTAGT No data
Right 1149239758 17:54635429-54635451 GACATTTCTAGGCACACCCTGGG No data
1149239750_1149239756 -3 Left 1149239750 17:54635398-54635420 CCTGAGGCCAAGCCCTACCTAGT No data
Right 1149239756 17:54635418-54635440 AGTTCATGGATGACATTTCTAGG No data
1149239750_1149239759 16 Left 1149239750 17:54635398-54635420 CCTGAGGCCAAGCCCTACCTAGT No data
Right 1149239759 17:54635437-54635459 TAGGCACACCCTGGGCCAAAAGG No data
1149239750_1149239763 26 Left 1149239750 17:54635398-54635420 CCTGAGGCCAAGCCCTACCTAGT No data
Right 1149239763 17:54635447-54635469 CTGGGCCAAAAGGGAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149239750 Original CRISPR ACTAGGTAGGGCTTGGCCTC AGG (reversed) Intergenic