ID: 1149241230

View in Genome Browser
Species Human (GRCh38)
Location 17:54652147-54652169
Sequence CTCTCTCCACATATGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149241230_1149241232 16 Left 1149241230 17:54652147-54652169 CCTTTCTGCATATGTGGAGAGAG No data
Right 1149241232 17:54652186-54652208 ATGTCTCTTCCTCTTCTTGCAGG No data
1149241230_1149241233 17 Left 1149241230 17:54652147-54652169 CCTTTCTGCATATGTGGAGAGAG No data
Right 1149241233 17:54652187-54652209 TGTCTCTTCCTCTTCTTGCAGGG No data
1149241230_1149241234 18 Left 1149241230 17:54652147-54652169 CCTTTCTGCATATGTGGAGAGAG No data
Right 1149241234 17:54652188-54652210 GTCTCTTCCTCTTCTTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149241230 Original CRISPR CTCTCTCCACATATGCAGAA AGG (reversed) Intergenic
No off target data available for this crispr