ID: 1149242040 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:54662485-54662507 |
| Sequence | CTGGAGAAATGGACAGAAGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1149242040_1149242045 | 10 | Left | 1149242040 | 17:54662485-54662507 | CCTACTTCTGTCCATTTCTCCAG | No data | ||
| Right | 1149242045 | 17:54662518-54662540 | ATCCAGTTCTGTGCCCTTGCTGG | 0: 19 1: 147 2: 776 3: 1291 4: 3461 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1149242040 | Original CRISPR | CTGGAGAAATGGACAGAAGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||