ID: 1149242040

View in Genome Browser
Species Human (GRCh38)
Location 17:54662485-54662507
Sequence CTGGAGAAATGGACAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149242040_1149242045 10 Left 1149242040 17:54662485-54662507 CCTACTTCTGTCCATTTCTCCAG No data
Right 1149242045 17:54662518-54662540 ATCCAGTTCTGTGCCCTTGCTGG 0: 19
1: 147
2: 776
3: 1291
4: 3461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149242040 Original CRISPR CTGGAGAAATGGACAGAAGT AGG (reversed) Intergenic
No off target data available for this crispr