ID: 1149248214

View in Genome Browser
Species Human (GRCh38)
Location 17:54736771-54736793
Sequence CCCAGGCAACATTCTAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149248207_1149248214 -7 Left 1149248207 17:54736755-54736777 CCTCATAAAACTCCCCCCCAGGC No data
Right 1149248214 17:54736771-54736793 CCCAGGCAACATTCTAAGGAAGG No data
1149248205_1149248214 2 Left 1149248205 17:54736746-54736768 CCTGTGTAGCCTCATAAAACTCC No data
Right 1149248214 17:54736771-54736793 CCCAGGCAACATTCTAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149248214 Original CRISPR CCCAGGCAACATTCTAAGGA AGG Intergenic
No off target data available for this crispr