ID: 1149249345

View in Genome Browser
Species Human (GRCh38)
Location 17:54750033-54750055
Sequence TGGGAGAGTGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149249345_1149249352 26 Left 1149249345 17:54750033-54750055 CCCACAATCACTGCACTCTCCCA No data
Right 1149249352 17:54750082-54750104 ATGCCACACAGTTGCTGCTGGGG No data
1149249345_1149249350 24 Left 1149249345 17:54750033-54750055 CCCACAATCACTGCACTCTCCCA No data
Right 1149249350 17:54750080-54750102 CTATGCCACACAGTTGCTGCTGG No data
1149249345_1149249351 25 Left 1149249345 17:54750033-54750055 CCCACAATCACTGCACTCTCCCA No data
Right 1149249351 17:54750081-54750103 TATGCCACACAGTTGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149249345 Original CRISPR TGGGAGAGTGCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr