ID: 1149251410

View in Genome Browser
Species Human (GRCh38)
Location 17:54774298-54774320
Sequence TACGATCCCCTTTTCAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149251410_1149251411 29 Left 1149251410 17:54774298-54774320 CCTCATCTGAAAAGGGGATCGTA No data
Right 1149251411 17:54774350-54774372 AAAGAAGATAATACATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149251410 Original CRISPR TACGATCCCCTTTTCAGATG AGG (reversed) Intergenic
No off target data available for this crispr