ID: 1149251427

View in Genome Browser
Species Human (GRCh38)
Location 17:54774561-54774583
Sequence CAATTTGCAGACAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149251427_1149251429 14 Left 1149251427 17:54774561-54774583 CCCATATCACTGTCTGCAAATTG No data
Right 1149251429 17:54774598-54774620 TTTGTAGCCCACACTGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149251427 Original CRISPR CAATTTGCAGACAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr