ID: 1149252187

View in Genome Browser
Species Human (GRCh38)
Location 17:54783250-54783272
Sequence TCATGTGCACGCATGTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149252187_1149252196 26 Left 1149252187 17:54783250-54783272 CCTGAGCACATGCGTGCACATGA No data
Right 1149252196 17:54783299-54783321 ACTAGGGGAAACTTTGAAAGGGG No data
1149252187_1149252190 10 Left 1149252187 17:54783250-54783272 CCTGAGCACATGCGTGCACATGA No data
Right 1149252190 17:54783283-54783305 AGCACTCCCAGATATAACTAGGG No data
1149252187_1149252194 24 Left 1149252187 17:54783250-54783272 CCTGAGCACATGCGTGCACATGA No data
Right 1149252194 17:54783297-54783319 TAACTAGGGGAAACTTTGAAAGG No data
1149252187_1149252189 9 Left 1149252187 17:54783250-54783272 CCTGAGCACATGCGTGCACATGA No data
Right 1149252189 17:54783282-54783304 GAGCACTCCCAGATATAACTAGG No data
1149252187_1149252195 25 Left 1149252187 17:54783250-54783272 CCTGAGCACATGCGTGCACATGA No data
Right 1149252195 17:54783298-54783320 AACTAGGGGAAACTTTGAAAGGG No data
1149252187_1149252191 11 Left 1149252187 17:54783250-54783272 CCTGAGCACATGCGTGCACATGA No data
Right 1149252191 17:54783284-54783306 GCACTCCCAGATATAACTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149252187 Original CRISPR TCATGTGCACGCATGTGCTC AGG (reversed) Intergenic
No off target data available for this crispr