ID: 1149253071

View in Genome Browser
Species Human (GRCh38)
Location 17:54792538-54792560
Sequence GATCAGTGCCCTAGTTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149253071_1149253075 2 Left 1149253071 17:54792538-54792560 CCTGCACAACTAGGGCACTGATC No data
Right 1149253075 17:54792563-54792585 ACATGGAAAGAAAGAAGAAGGGG No data
1149253071_1149253073 0 Left 1149253071 17:54792538-54792560 CCTGCACAACTAGGGCACTGATC No data
Right 1149253073 17:54792561-54792583 ATACATGGAAAGAAAGAAGAAGG No data
1149253071_1149253074 1 Left 1149253071 17:54792538-54792560 CCTGCACAACTAGGGCACTGATC No data
Right 1149253074 17:54792562-54792584 TACATGGAAAGAAAGAAGAAGGG No data
1149253071_1149253076 30 Left 1149253071 17:54792538-54792560 CCTGCACAACTAGGGCACTGATC No data
Right 1149253076 17:54792591-54792613 GACTAGCTGTCGCTAAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149253071 Original CRISPR GATCAGTGCCCTAGTTGTGC AGG (reversed) Intergenic
No off target data available for this crispr