ID: 1149268545

View in Genome Browser
Species Human (GRCh38)
Location 17:54953394-54953416
Sequence CAGGTTACACAGAAGAAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149268545_1149268561 20 Left 1149268545 17:54953394-54953416 CCCCCCTTCTTCTGTGTAACCTG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 1149268561 17:54953437-54953459 GGATCTTGTTTTGAGGAGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 149
1149268545_1149268555 -10 Left 1149268545 17:54953394-54953416 CCCCCCTTCTTCTGTGTAACCTG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 1149268555 17:54953407-54953429 GTGTAACCTGGGGCTCCTTGGGG 0: 1
1: 0
2: 3
3: 11
4: 131
1149268545_1149268562 24 Left 1149268545 17:54953394-54953416 CCCCCCTTCTTCTGTGTAACCTG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 1149268562 17:54953441-54953463 CTTGTTTTGAGGAGCCAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 213
1149268545_1149268558 -1 Left 1149268545 17:54953394-54953416 CCCCCCTTCTTCTGTGTAACCTG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 1149268558 17:54953416-54953438 GGGGCTCCTTGGGGGAGATGTGG 0: 1
1: 0
2: 2
3: 39
4: 392
1149268545_1149268563 25 Left 1149268545 17:54953394-54953416 CCCCCCTTCTTCTGTGTAACCTG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 1149268563 17:54953442-54953464 TTGTTTTGAGGAGCCAGGCAGGG 0: 1
1: 0
2: 2
3: 56
4: 675
1149268545_1149268560 13 Left 1149268545 17:54953394-54953416 CCCCCCTTCTTCTGTGTAACCTG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 1149268560 17:54953430-54953452 GAGATGTGGATCTTGTTTTGAGG 0: 1
1: 0
2: 1
3: 25
4: 204
1149268545_1149268556 -9 Left 1149268545 17:54953394-54953416 CCCCCCTTCTTCTGTGTAACCTG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 1149268556 17:54953408-54953430 TGTAACCTGGGGCTCCTTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149268545 Original CRISPR CAGGTTACACAGAAGAAGGG GGG (reversed) Intronic
901051454 1:6427711-6427733 CACGTGACACCGAGGAAGGGTGG + Intronic
903154695 1:21435846-21435868 CAGGTCACACAGTTGATGGGAGG - Intergenic
904437348 1:30507435-30507457 GAGGTTGCACAGAGGAAGGAGGG - Intergenic
905298076 1:36967240-36967262 CAGCTTGCAGTGAAGAAGGGAGG - Intronic
905878868 1:41450675-41450697 CAGGATCCACACAAGACGGGTGG + Intergenic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
912651969 1:111448357-111448379 CAGGTTACACAGAAGAAAAATGG + Intronic
915376387 1:155399956-155399978 TAGGTTACACAAGATAAGGGTGG + Intronic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
918079128 1:181192213-181192235 CAGGGAACACAGAAGATGTGAGG - Intergenic
919342147 1:196325276-196325298 CAGGTTACAGACAGGAAGGTAGG - Intronic
919807026 1:201386291-201386313 CAGGTGGCAGAGTAGAAGGGTGG + Intronic
922236455 1:223726256-223726278 CAGACCCCACAGAAGAAGGGAGG - Intronic
922567652 1:226611357-226611379 CAGGTTCCACATAGGAAAGGGGG + Intergenic
922751553 1:228072513-228072535 CAAGTGACACAGAAACAGGGAGG - Intergenic
923553620 1:234983712-234983734 AAGGTCACACAGCATAAGGGTGG + Intergenic
1065310785 10:24414463-24414485 CAGGTAACAAAGCAGATGGGAGG + Intronic
1069793441 10:71038225-71038247 GAGGTTACACAGCAAAAGGGAGG - Intergenic
1070662189 10:78315001-78315023 CAGGTTGAACAGTAGAAGGAAGG - Intergenic
1071099172 10:82014830-82014852 CAGGCTAGAAAGAGGAAGGGAGG + Intronic
1073862254 10:107760390-107760412 CAAGTTACCCAAGAGAAGGGTGG - Intergenic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1076266007 10:129110447-129110469 CAGCTTGCACAGAGGCAGGGAGG - Intergenic
1076703326 10:132285486-132285508 CAGGTTAAAAAGGAAAAGGGTGG + Intronic
1079512605 11:21228762-21228784 CAGGTTACAAAAAAGAGGAGAGG - Intronic
1079706540 11:23627431-23627453 CAGGTTACACAGCAGAATGCAGG - Intergenic
1080268523 11:30425859-30425881 CAGGTTTGAAAGAAAAAGGGAGG + Intronic
1080855312 11:36106807-36106829 CAGGTCACACAGCAGAGGGAGGG - Intronic
1081100463 11:38995478-38995500 CAGATTTCTCAGAAGAAGGAAGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083059259 11:59852463-59852485 CATGTTGCTCAGAAGAAAGGGGG - Intergenic
1085452197 11:76641145-76641167 GAGGCTACACTGAAGTAGGGTGG + Intergenic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085774456 11:79352744-79352766 AAGGAGACAGAGAAGAAGGGAGG + Intronic
1086124553 11:83336894-83336916 GAGGTGAGAGAGAAGAAGGGAGG + Intergenic
1086337245 11:85811613-85811635 CATGTGAAATAGAAGAAGGGGGG + Intergenic
1088112860 11:106282036-106282058 CAGGTTCCACAAAGGAAGAGGGG - Intergenic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1090227211 11:125078937-125078959 CAGGTGTCACAGAAGCAGTGGGG + Intronic
1090776243 11:129968509-129968531 CAGGTTCCACAGAAGAGAGGGGG + Intronic
1091011527 11:132005754-132005776 CAGGTGAAACAGAAAATGGGAGG - Intronic
1092127404 12:6084631-6084653 CAGCTGACAAAGGAGAAGGGAGG + Intronic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1092747609 12:11688569-11688591 CAGGTTACACAGCAGGATGCAGG - Intronic
1093281109 12:17197423-17197445 CAGGTACCACTGAAGAATGGGGG - Intergenic
1093576726 12:20739606-20739628 TGGCTTACACAGAAGAAGAGAGG + Intronic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1097229200 12:57498884-57498906 CAGGACACAGAGAGGAAGGGAGG - Intronic
1097740467 12:63235910-63235932 GAAGTTACACATGAGAAGGGTGG - Intergenic
1098738873 12:74144892-74144914 CAGTTAAAACAGAAGAAAGGAGG - Intergenic
1100206629 12:92356771-92356793 CAGCTTGCTCAGAAGAGGGGAGG + Intergenic
1100358954 12:93858753-93858775 AGTGTTACACAGAAGAATGGTGG - Intronic
1101648275 12:106651696-106651718 CAGGGTACAAAGAAATAGGGAGG + Intronic
1101768705 12:107728285-107728307 CAGGCTACAGAGATGAGGGGAGG - Intergenic
1102609068 12:114095349-114095371 CAGGTTTCTCAGAGGAAGGTGGG + Intergenic
1107644547 13:42480173-42480195 CAGGTTCCACATCAGAAGGAAGG - Intergenic
1107730353 13:43342263-43342285 GCGGTTACAATGAAGAAGGGTGG + Intronic
1108463689 13:50693532-50693554 CAGTTTACAGAGAGGGAGGGTGG - Intronic
1111746337 13:92274432-92274454 CGAGTTACTCAGGAGAAGGGTGG - Intronic
1112181063 13:97081259-97081281 CAGGTTAAACATAAGAAAAGGGG + Intergenic
1113518221 13:110919387-110919409 GAGGTCACACTGAAGTAGGGTGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114440959 14:22747322-22747344 CAGGTTCCACACAGGAAGAGGGG + Intergenic
1116389920 14:44379873-44379895 CAGTTTACACAGGGAAAGGGAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117210763 14:53496496-53496518 CAGGTTTGACAGAGGAATGGAGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1119330387 14:73789138-73789160 CAGCTTACACTTAAGGAGGGAGG - Intronic
1120222343 14:81748558-81748580 CTGGTTACAGTGAAGAAGAGAGG + Intergenic
1120720039 14:87880823-87880845 AAGGTAACACAGCAGGAGGGAGG + Intronic
1121377612 14:93428845-93428867 CAGGTTACACAGATCATGAGAGG + Intronic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1126950159 15:53871999-53872021 CAGGTTCTCCTGAAGAAGGGAGG - Intergenic
1131865313 15:96702572-96702594 CAGGATACACAGAAAAATGTAGG - Intergenic
1133064248 16:3194911-3194933 CAGAAGTCACAGAAGAAGGGCGG - Intergenic
1133098662 16:3465650-3465672 GGGGTCACACAGAAGAAGGCAGG - Intronic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1135200192 16:20430644-20430666 TAGGGAACAAAGAAGAAGGGAGG + Intronic
1135218498 16:20592965-20592987 TAGGGAACAAAGAAGAAGGGAGG - Intergenic
1135973874 16:27092797-27092819 CAGGTAACCCAGAGGAAGGCAGG + Intergenic
1136056158 16:27691219-27691241 CATGTCACACAGAAGACGTGAGG - Intronic
1138828531 16:60351209-60351231 CAGGTTACACAGACAGAGGTTGG + Intergenic
1139573903 16:67829513-67829535 CTTGCTACAAAGAAGAAGGGTGG + Exonic
1141685339 16:85566824-85566846 CAGGGAACATAAAAGAAGGGAGG + Intergenic
1143071576 17:4299764-4299786 CAGGTAAAATAGAAGAAGAGGGG - Intronic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149456045 17:56789446-56789468 CAGGGTACATGGAACAAGGGTGG - Intergenic
1149807341 17:59631171-59631193 CAGGATACACAATATAAGGGAGG - Intronic
1150006923 17:61475693-61475715 CAGGTGTCACAGGAGCAGGGTGG + Intronic
1150635736 17:66911870-66911892 CAGGTTAAAAAGAGGATGGGTGG - Intergenic
1155267254 18:24106061-24106083 CAGGTCACACTGGAGTAGGGTGG - Intronic
1156389946 18:36640996-36641018 CATGTTGCAGAGAAGAAGGATGG - Intronic
1156787313 18:40931362-40931384 GAGGTAAGGCAGAAGAAGGGAGG - Intergenic
1159903963 18:74074165-74074187 CAGGTTTCTCAGAAGAGGGGAGG - Intronic
1160953548 19:1679185-1679207 CAGTTTCCCCAGAAGATGGGGGG - Intergenic
1161025701 19:2035735-2035757 CTGGTTTCACAGAAGACGCGAGG - Intergenic
1161771246 19:6231909-6231931 AATGTCACACGGAAGAAGGGAGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164737956 19:30555806-30555828 CAGGTTCTAATGAAGAAGGGAGG + Intronic
1164827840 19:31297352-31297374 CAGTCTTCACAGCAGAAGGGTGG - Intronic
1164905191 19:31961378-31961400 CATGGTGCACAGAAGAAGGGAGG - Intergenic
1166519506 19:43471072-43471094 GAGGTTACACAGCAAGAGGGTGG - Intergenic
1166567176 19:43772327-43772349 CAGGTCACACAGCAGAGAGGAGG - Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
926543584 2:14210629-14210651 CAGGTTACACAGAGCAGTGGGGG - Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927609676 2:24525385-24525407 AAGGATACAGAGAACAAGGGTGG + Intronic
927884555 2:26710479-26710501 CAGGCTTCAGAGAAGAGGGGAGG + Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
929010923 2:37443380-37443402 CAGGTCACAGAGATGAGGGGTGG + Intergenic
929120581 2:38480857-38480879 AAGGCACCACAGAAGAAGGGTGG + Intergenic
929544986 2:42849840-42849862 CAGGGTGCACAGTGGAAGGGAGG - Intergenic
929609847 2:43262932-43262954 CACATTACACAGAAGTGGGGAGG - Intronic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
931794468 2:65696103-65696125 CAGATTACAGAGACAAAGGGTGG - Intergenic
933450390 2:82442003-82442025 AGGGTTACACTGAAGTAGGGAGG - Intergenic
933639053 2:84740448-84740470 CAGGGCACTGAGAAGAAGGGTGG + Intronic
933872273 2:86578683-86578705 CAAGTTACACACAAGAAAAGAGG + Intronic
937721465 2:125101757-125101779 GAGGTTACAGAGAAGAAGGATGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
939015117 2:136893682-136893704 TAAGGTACACAGAAGAAGGTGGG - Intronic
939505286 2:143038480-143038502 CAGGTTACACAGAACTTGGTAGG - Intronic
941365909 2:164611287-164611309 AAGCTAACACAGAAGAAAGGAGG + Intronic
942098251 2:172554362-172554384 TAGGTCCCGCAGAAGAAGGGTGG + Intergenic
943760592 2:191604113-191604135 CCTGTTACACAGAAGCAGAGAGG - Intergenic
944824703 2:203470269-203470291 AATGTTTCTCAGAAGAAGGGAGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
947659381 2:231855403-231855425 CTGGTTACACAGGAGAGGAGAGG - Intergenic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
947822540 2:233082042-233082064 CAGCTTTCAGAGAAGATGGGCGG + Intronic
947982835 2:234425253-234425275 CGGGCTACAAAGATGAAGGGTGG + Intergenic
948313746 2:237010755-237010777 AAGGTTCCACAGAAGTAGGGGGG - Intergenic
1169594800 20:7185974-7185996 AAAGTTATAGAGAAGAAGGGAGG + Intergenic
1172837981 20:37885199-37885221 CAGGTCACACACAGGAAGGCTGG - Intergenic
1173190305 20:40870890-40870912 GAGGTTATACAGAAGTAGGTTGG - Intergenic
1174033875 20:47653615-47653637 CATGATACACAGCAGAAGGAGGG - Exonic
1174130478 20:48340561-48340583 CAGGCTACAGAGCAGCAGGGAGG + Intergenic
1176896694 21:14387011-14387033 GAGGTCACACAGAAATAGGGTGG + Intergenic
1177220352 21:18184738-18184760 CAGTTGACATAGAAGAAGGTTGG - Intronic
1177543947 21:22532711-22532733 GAGGTTATACAGAAGTAGTGTGG + Intergenic
1177567496 21:22843894-22843916 CAGGTTCCAGAGATGAAGGAGGG + Intergenic
1177957166 21:27613082-27613104 CAGCGTACACTGAAGAAGTGGGG + Intergenic
1178671327 21:34594250-34594272 AATGTTTCACAAAAGAAGGGTGG + Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181973970 22:26714921-26714943 CAGGCTCCCCAGAAGAAGAGCGG - Intergenic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
950982039 3:17317325-17317347 CAGGTAACTCACAAGAAGGCAGG + Intronic
951249373 3:20376810-20376832 CAGGTTACACTGATGATGGTTGG - Intergenic
953632224 3:44628754-44628776 CAGGTTACACAGGAGTAGTCAGG + Intronic
953673660 3:44983237-44983259 GAGGTTACAGATAAGAATGGAGG - Intronic
953777853 3:45838318-45838340 CAGGTTTCAGAGAAACAGGGAGG - Intronic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955747963 3:62158655-62158677 CAGGTTCCCTAGAAGAAGGTAGG + Intronic
956069694 3:65434813-65434835 GAGACTACACAGTAGAAGGGTGG + Intronic
956318279 3:67964988-67965010 CAGGTCACACGGAATTAGGGTGG - Intergenic
957115789 3:76023893-76023915 CAGGTTACAGAGAAAAAAAGTGG + Intronic
959740459 3:109712630-109712652 GAGGTTACAGAGAAGCAAGGAGG + Intergenic
960526920 3:118720563-118720585 CAGGCTCCACAGAAGAACGGAGG - Intergenic
961094862 3:124145534-124145556 CATGTCACTCAGAAGAAGAGGGG - Intronic
962319798 3:134381327-134381349 AGGGTTTCACAGAAAAAGGGTGG + Intergenic
963154895 3:142086037-142086059 CAGGTGAAAAAGAACAAGGGCGG - Intronic
963280247 3:143377527-143377549 CAGGTTACACACAAGAATAAAGG + Intronic
966308953 3:178572148-178572170 CAGCATATACAAAAGAAGGGTGG + Intronic
966786298 3:183625671-183625693 CAAGATACACAGAAAAAGAGAGG - Intergenic
967339695 3:188382847-188382869 CAGGTTACAGAGGATAAGAGGGG - Intronic
967920312 3:194609435-194609457 CAGGAAACACAGAAGAGTGGGGG + Intronic
968159433 3:196413484-196413506 TAAGTTACACAGAACCAGGGAGG + Intronic
968566575 4:1316619-1316641 CTGGTTAGACAGAAGCAGGGAGG - Intronic
968949332 4:3682430-3682452 CAGGCGTCACAGATGAAGGGTGG + Intergenic
970538962 4:17058592-17058614 CATGTTACAGAGGAGAAGTGGGG - Intergenic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
972742198 4:41898084-41898106 AAGCTTATACTGAAGAAGGGTGG - Intergenic
972879330 4:43404962-43404984 CAATTCACACAGAAGAGGGGAGG + Intergenic
973832755 4:54778669-54778691 CAGGTTACAGAAAAGAAGGCAGG - Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976614826 4:87065805-87065827 GAGGTTGCACAGAGAAAGGGGGG - Intronic
977912600 4:102555276-102555298 CAGGCTACACTGAAAAAGGAGGG - Intronic
979629786 4:122887417-122887439 CAGGTTACACACAAGCAAGTGGG - Intronic
981490672 4:145336269-145336291 CAGGTTACACAGGAGTGAGGAGG - Intergenic
981663557 4:147195643-147195665 TAGGTGACACAGAAGAGGGAGGG + Intergenic
982602655 4:157470895-157470917 CAGGTTGCACAGAGAGAGGGAGG - Intergenic
982605902 4:157515613-157515635 CAGGTAAAAACGAAGAAGGGAGG - Intergenic
983246742 4:165296304-165296326 CAAGTTACAGAGAAGAAAGGAGG - Intronic
984340631 4:178452003-178452025 GATGATACACAGAAGAGGGGAGG + Intergenic
986288546 5:6378916-6378938 CCGATTACATAGAAGAAAGGAGG - Intergenic
986676802 5:10192993-10193015 CTGGTTCAACAGAAGAAGGGTGG - Intergenic
987441965 5:17967434-17967456 AAGGTTACACAGAAAACTGGAGG + Intergenic
988619429 5:32807695-32807717 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
988988941 5:36650540-36650562 CAAATTACAAATAAGAAGGGTGG - Intronic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
990987009 5:61649890-61649912 CAGATGACACAGAAGGAGAGGGG - Intronic
991017194 5:61944980-61945002 CAGGTAACACAGAGGAAAGCTGG + Intergenic
991531958 5:67625021-67625043 CATGTTAGAAAGTAGAAGGGTGG - Intergenic
995030684 5:107477611-107477633 CAGGTTACCCAAAAGAAAGAAGG - Intronic
996683261 5:126251280-126251302 AAGGTTACACTGGAGTAGGGTGG - Intergenic
999410098 5:151343050-151343072 CAGGAGACACAGAACAAGGCAGG + Intronic
999571851 5:152927556-152927578 CAGGTGACACAGAAGGAGTTAGG + Intergenic
999639523 5:153658220-153658242 AAGAATACACAGAACAAGGGTGG + Intronic
1002771674 6:295420-295442 CAGATTATACAGAAGATGGAGGG + Intronic
1003911351 6:10747084-10747106 CAGGAAACACAGAAGAGGAGCGG + Intergenic
1004197632 6:13519300-13519322 CAGTTTATACAGAAAAAGGCAGG - Intergenic
1006916363 6:37596528-37596550 CAGGTTTAAAAGAAGAAGGTGGG + Intergenic
1010472780 6:76249555-76249577 CAGGAGACACAGAAGACGGGTGG + Intergenic
1012420556 6:99060012-99060034 AAGGTTACACAGAAGTACGTAGG + Intergenic
1014161757 6:118177941-118177963 CAGGTAGCACAGAAGTAAGGAGG - Intronic
1014726332 6:124976290-124976312 CAGGTGACAGGGAGGAAGGGAGG - Intronic
1016094444 6:140018950-140018972 CAGGTTCCATAGCAGAAAGGAGG - Intergenic
1016657342 6:146536481-146536503 CAGGTTACACATAAACAGGTGGG + Intergenic
1017747280 6:157458161-157458183 CAGGGTAGGTAGAAGAAGGGAGG + Intronic
1017800667 6:157892885-157892907 GAGGTTACACAGCGGAAGAGAGG + Intronic
1019558863 7:1645961-1645983 CAGGTTACACAGACCACGCGGGG + Intergenic
1019826892 7:3291994-3292016 AAGGTTAGACAGAAGATGGCAGG - Intergenic
1021566060 7:22017581-22017603 CAGGTCAGGAAGAAGAAGGGAGG - Intergenic
1023232935 7:38052915-38052937 CAGTTTACACACAAGAGGAGTGG + Intergenic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023739244 7:43263700-43263722 TAGGAAACAGAGAAGAAGGGAGG + Intronic
1023758976 7:43445633-43445655 CAGTTTAAAAACAAGAAGGGCGG + Intronic
1026358159 7:69578032-69578054 CAGGTTCCAGAGAAGATTGGTGG - Intergenic
1028255710 7:88594882-88594904 CTGGTTTCATAGAATAAGGGAGG - Intergenic
1028433119 7:90771126-90771148 CAGGATACAAAGAACAAGTGAGG - Intronic
1029352400 7:100023549-100023571 CAGGCTGCACAGGAGAAGGATGG + Exonic
1030377024 7:108764766-108764788 CAGGTAACACAGAAGTATAGTGG + Intergenic
1030714692 7:112793754-112793776 TATATTACACAGAATAAGGGAGG - Intergenic
1031414847 7:121483610-121483632 CAGGTTACACTCAAGAAGAACGG - Intergenic
1032200611 7:129820051-129820073 CTGGGTACACAGAAGTGGGGAGG + Intergenic
1032467463 7:132155260-132155282 CAGGTTACACAGCAGGGAGGTGG - Intronic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034706027 7:153145319-153145341 CAAGTTACACAGAACTGGGGTGG + Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1037578909 8:20233136-20233158 GAGGTCACACTGAAGTAGGGTGG + Intergenic
1037734396 8:21555108-21555130 CAGCTTACAGAGGAGAAGGAGGG + Intergenic
1038105276 8:24426645-24426667 CATGTGACACAGAAGAAGGTAGG - Intergenic
1039792116 8:40884299-40884321 CAGGGTACAAAGATGATGGGTGG - Intronic
1041768573 8:61447467-61447489 CAAGTAACCCAGAAGAAGGCAGG - Intronic
1042316717 8:67433661-67433683 CAGGTTACACAGAAAAAGTCAGG - Intronic
1042504272 8:69542911-69542933 CACATTACACAGAATAATGGGGG + Intronic
1043052874 8:75404710-75404732 CAGTTTACACGCAGGAAGGGGGG - Intergenic
1043790584 8:84462903-84462925 CAGGTTATACAAAACAAAGGTGG - Intronic
1044745260 8:95364974-95364996 CAGGTTACACTGAAGGGTGGAGG - Intergenic
1045544242 8:103113889-103113911 CAGCAAACACAGTAGAAGGGAGG + Intergenic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1048053875 8:130845853-130845875 AAGGATAGAAAGAAGAAGGGAGG + Intronic
1048445897 8:134493165-134493187 CAGGTGACACAGGAAATGGGTGG - Intronic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1050140917 9:2514785-2514807 CAGATTGAATAGAAGAAGGGAGG - Intergenic
1050447872 9:5745552-5745574 CAGGTTACCCAGTAGAAGCCTGG - Intronic
1050951253 9:11598450-11598472 CAGGTTATAAAAAAGAAGTGTGG - Intergenic
1051286421 9:15501954-15501976 CACGCTACACAGCAGGAGGGAGG + Intronic
1051900439 9:22032958-22032980 CAGGCTGCACAGCAGAAGGTGGG + Exonic
1052336764 9:27328219-27328241 CAGGTTAGGAAGAAGAAGGAGGG + Exonic
1053165189 9:35839517-35839539 CACGTTACACAGTTGAAGGAAGG + Intronic
1057923593 9:99121516-99121538 CAGATTACTCAGAAGAACTGGGG + Intronic
1058388032 9:104461500-104461522 CAGGTAAGAGAGAAGAAGGAAGG + Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059180550 9:112208672-112208694 CAGGTTAAACTGTAGAAGGCTGG - Intergenic
1059412242 9:114139643-114139665 CAGGGTCCCCAGAGGAAGGGAGG + Intergenic
1060667264 9:125439344-125439366 CAGGTCACACAGCAGGTGGGAGG - Intronic
1061706047 9:132453989-132454011 TAGGTTGCCCAGAAGGAGGGCGG + Intronic
1186695369 X:12025130-12025152 TAGGTTACACAGAAGAAAGAAGG - Intergenic
1187658084 X:21503887-21503909 CAGGTAAAAGAGAAGAAAGGCGG - Intronic
1191894515 X:65977664-65977686 GAGGTTACAGAGAAAAAGGAAGG - Intergenic
1192699900 X:73457811-73457833 CTGGTGACAAAAAAGAAGGGAGG + Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193747683 X:85301708-85301730 TATTTTACACAGAAGAAGGCAGG + Intronic
1194625580 X:96222747-96222769 CTGGTTACAAAGAAGAACTGTGG - Intergenic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1197390978 X:125864076-125864098 CTGCTTTCACAGAATAAGGGAGG - Intergenic
1198224450 X:134632456-134632478 ATGGTGACAGAGAAGAAGGGAGG - Intronic
1200007361 X:153096387-153096409 CAGATTGCACAGAAGTAGGGAGG + Intergenic
1201864728 Y:18637687-18637709 AAGGTTAAAGAGAAGAAGGCAGG - Intergenic
1201868594 Y:18682691-18682713 AAGGTTAAAGAGAAGAAGGCAGG + Intergenic