ID: 1149274757

View in Genome Browser
Species Human (GRCh38)
Location 17:55021130-55021152
Sequence TATGAGGTTCCAGCATTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149274755_1149274757 -1 Left 1149274755 17:55021108-55021130 CCATTTTACTGAAAGTGTTCACT 0: 1
1: 0
2: 0
3: 30
4: 307
Right 1149274757 17:55021130-55021152 TATGAGGTTCCAGCATTGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149274757 Original CRISPR TATGAGGTTCCAGCATTGTT TGG Intronic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
903313001 1:22475024-22475046 TAGGAGGGTGCAGAATTGTTAGG + Intronic
905148384 1:35906250-35906272 AATGAGGTTCCAACAGTGATGGG - Intronic
905992433 1:42350265-42350287 TAGGAGCTGCCAGCATTCTTTGG + Intergenic
906114186 1:43345153-43345175 GAAAGGGTTCCAGCATTGTTGGG + Intronic
908463037 1:64364755-64364777 TATTTTGTTCCAGCATTATTGGG + Intergenic
909893075 1:81032460-81032482 GCTGAGGTCCCAGGATTGTTTGG - Intergenic
912489722 1:110055455-110055477 TTTGATGTGCCAGCATGGTTAGG + Intronic
915847267 1:159279518-159279540 TATGTGGGTCCTGCAGTGTTGGG - Intergenic
916373772 1:164129161-164129183 GATTAGGTGCCAGCATGGTTGGG + Intergenic
921046536 1:211481761-211481783 CATGTGTTTCCAGCTTTGTTGGG - Intronic
921450509 1:215300446-215300468 TATGAGGTTGCTCCATTGATGGG + Intergenic
1067113722 10:43418988-43419010 GATGGGGTTCCACCATTGGTTGG + Intergenic
1067554963 10:47262466-47262488 GATCAGGTGCCAGCATGGTTGGG - Intergenic
1069649868 10:70038491-70038513 TATGAGTTTCCAACATTGTAGGG - Intergenic
1071322767 10:84480753-84480775 TATGGTCTTCCAGCCTTGTTTGG + Intronic
1071385928 10:85121278-85121300 TATGAGGCTCTAGCTTTGCTAGG + Intergenic
1078137979 11:8668318-8668340 AAAAAAGTTCCAGCATTGTTGGG - Intronic
1082572390 11:54759462-54759484 AATGAATTTTCAGCATTGTTAGG - Intergenic
1082873001 11:57960986-57961008 TATGAGGCTCTAGCAGTTTTAGG - Intergenic
1085580456 11:77645545-77645567 TATGTGGTCCACGCATTGTTTGG + Intergenic
1085987014 11:81799980-81800002 AATGAGGTTTCACCATTATTGGG - Intergenic
1086600280 11:88625011-88625033 TATGAGGTACAGTCATTGTTTGG - Intronic
1086784445 11:90949581-90949603 TATGAGGTACCAAAATTGGTAGG + Intergenic
1088252807 11:107876191-107876213 TCTAAGGTTCTTGCATTGTTTGG - Intronic
1091852382 12:3710412-3710434 GATCAGGTGCCAGCATGGTTGGG + Intronic
1094257705 12:28453840-28453862 TGTGAGGTTACAGGAATGTTCGG - Intronic
1095278306 12:40317747-40317769 TATGAGGTTGAAGGAATGTTAGG + Intronic
1097173949 12:57132174-57132196 TAGCAGGATCCTGCATTGTTTGG + Intronic
1099485076 12:83219440-83219462 ACTGAGTTTCCAGCATTGTTTGG - Intergenic
1103598677 12:122040342-122040364 GATGGGGTTTCACCATTGTTTGG - Intronic
1107221585 13:37987948-37987970 TATGTGGTTCGAGCATTATCAGG + Intergenic
1108856134 13:54794973-54794995 TTTGAGCTTCCAGAATTGTGAGG + Intergenic
1113353037 13:109548312-109548334 TATGAGGTTGAAATATTGTTAGG - Intergenic
1113790629 13:113026158-113026180 TGTGAGGTTCCACCATGGTGGGG + Intronic
1113790659 13:113026266-113026288 TGTGAGGTTCCACCATGGTGGGG + Intronic
1115169783 14:30491733-30491755 TGTGATGTTTCAGCAGTGTTTGG - Intergenic
1115510914 14:34137123-34137145 TAGCAGGTTCCAGCCTTGTTAGG - Intronic
1117062740 14:51980057-51980079 TCTGGGCTTCCAGCTTTGTTAGG + Intergenic
1117084355 14:52183673-52183695 TAGGAAGCTCCAGCATTGTGTGG - Intergenic
1120362664 14:83525330-83525352 TAAAAGGTTCCAGGATTTTTTGG + Intergenic
1125616924 15:41022763-41022785 TATGAGATTCTAGTATTGTTTGG - Intronic
1129513085 15:76139237-76139259 TGTGTGGTTTCACCATTGTTAGG - Intronic
1130415737 15:83693250-83693272 TATAAGGTGTGAGCATTGTTGGG + Intronic
1132497242 16:269659-269681 GAGGAGGCTCCAGCAATGTTTGG - Intronic
1139587074 16:67910958-67910980 TGTGAGGTTTCAGCACTGTTGGG + Intronic
1143147868 17:4788520-4788542 TATTAAGTTCAAGCATTGTCCGG - Intergenic
1143694842 17:8605880-8605902 TATGAGATTCCAGCTATGTTTGG + Intronic
1147238569 17:39075592-39075614 TATCAAGATCCAGGATTGTTGGG + Intronic
1149274757 17:55021130-55021152 TATGAGGTTCCAGCATTGTTTGG + Intronic
1151412460 17:73940455-73940477 TGTGAGGTCCCAGCACTGGTGGG + Intergenic
1156319621 18:36006797-36006819 TGTCAGGTTCTAGGATTGTTAGG - Intronic
1158332078 18:56374085-56374107 AAAGAAGTTCCAGCATTTTTGGG - Intergenic
1158571141 18:58597979-58598001 ATTGAGGTGCCAGCATGGTTAGG - Intronic
1162048761 19:8019237-8019259 TATGTAATTCCAGCATTTTTGGG + Intronic
1163044492 19:14629534-14629556 TTTGTGATTTCAGCATTGTTAGG + Intronic
1164067646 19:21734115-21734137 TTTGAGTTTTCAGCATTTTTTGG - Intronic
1167897062 19:52590581-52590603 AATGAGTTTCCAACATTGTTTGG + Intergenic
925562107 2:5207476-5207498 TCTGAGGTCCTAGCATTTTTGGG + Intergenic
931126961 2:59288964-59288986 TGTGCTGTTCCAGCATTGCTTGG + Intergenic
933306926 2:80612345-80612367 TATCAGTTTCCAACATTTTTAGG - Intronic
941812067 2:169765147-169765169 TTTAAGGTTCTAGCATTGTCAGG + Intronic
942979437 2:182061783-182061805 TCTGGGGTTCCAGCATTACTTGG - Intronic
946285852 2:218701957-218701979 AATGAGTTTCCTGCAGTGTTTGG - Exonic
1170955297 20:20974092-20974114 CAGGAGGTGCCAGCAATGTTTGG + Intergenic
1172984739 20:38975571-38975593 CATGATGTTCCAGAATTGTTTGG + Intronic
1174661519 20:52217425-52217447 TATGCTGCTCCAGAATTGTTTGG + Intergenic
1176911179 21:14566956-14566978 TAAGAGTTTCCAATATTGTTTGG - Intronic
1179468100 21:41591450-41591472 TATGAGCCTCGAGCCTTGTTTGG + Intergenic
1182122326 22:27796260-27796282 TTTTAGGTGCCAGCATTTTTAGG - Intronic
954990929 3:54840099-54840121 TAAGAGGCTCAAGAATTGTTTGG - Intronic
955279918 3:57584835-57584857 TATGAACTACCAGCATTTTTTGG + Intronic
956916558 3:73878065-73878087 GATGAGCTTCCTGCAGTGTTTGG + Intergenic
960867413 3:122215885-122215907 CATGAGGTTGCAGAAGTGTTGGG + Intronic
963311065 3:143710501-143710523 TATGAAGCTGCAACATTGTTTGG + Intronic
963726313 3:148925841-148925863 TTTGAGTTTCCATCATTTTTTGG - Intergenic
964321402 3:155501604-155501626 GATGAGGTTTCACCATTTTTTGG - Intronic
970249409 4:14098214-14098236 TATGGGCTTCCAGCATTGCTTGG + Intergenic
971242583 4:24901918-24901940 TAAGGGGTTACAGCATTGATGGG - Intronic
974471499 4:62324492-62324514 TAATAGGTTTGAGCATTGTTTGG + Intergenic
976923554 4:90467812-90467834 TCAGAGGTTCCAGTAGTGTTTGG + Intronic
981142210 4:141282161-141282183 TAAGAGTTTCCAGATTTGTTTGG - Intergenic
982027597 4:151266786-151266808 TATGAGTTTCTGCCATTGTTAGG - Intronic
982750097 4:159150792-159150814 AATGAGGATCCAGCAGTATTTGG + Intronic
985900272 5:2783203-2783225 TATCAGGCTCCAGATTTGTTTGG - Intergenic
989349914 5:40474475-40474497 TGTGAGGTGGCAGCCTTGTTGGG - Intergenic
992025794 5:72667479-72667501 AATGAGGTTTTAGCATTTTTTGG - Intergenic
994600646 5:101899814-101899836 TATAAGGTTCCAGAATAGCTGGG + Intergenic
997761629 5:136454197-136454219 AGAGAGGTTCCAGCAGTGTTGGG - Intergenic
1006403472 6:33831093-33831115 TTTGAGGTTGCAGCATTTTCGGG + Intergenic
1011400196 6:86952959-86952981 TATGGGCTTCCATTATTGTTGGG + Intronic
1016914869 6:149235489-149235511 TTTGAGGTAGCAGCCTTGTTTGG + Intronic
1016950505 6:149574920-149574942 TCTAAGGTTCTTGCATTGTTTGG - Intronic
1018065823 6:160124663-160124685 TAAGAGATGCCAGCATTGTCAGG + Intronic
1018832109 6:167451151-167451173 TATGGGCTCCCACCATTGTTTGG - Intergenic
1020999521 7:15311238-15311260 TATGAGTTTCCATATTTGTTTGG - Intronic
1025026748 7:55522617-55522639 TGTCAGGTTCCAGGAATGTTTGG - Intronic
1026683561 7:72489054-72489076 TATGTGGTTCAAGGATTATTGGG + Intergenic
1026818545 7:73531063-73531085 TAAAAGGTTTCAGCAGTGTTTGG - Intergenic
1030416465 7:109250447-109250469 TCTGAGGTTCCAACACCGTTAGG + Intergenic
1035172725 7:157027918-157027940 TATATAGATCCAGCATTGTTTGG - Intergenic
1039345019 8:36693830-36693852 AATGAGGTTCCAGCAGTTTCTGG + Intergenic
1039602112 8:38848236-38848258 TAGGAGGCTCCAGCACTGTCAGG - Exonic
1046540605 8:115576732-115576754 TTTGAGGTTCCAGCTGGGTTTGG - Intronic
1052463097 9:28792875-28792897 TATGAGTTTCCAGCATTCACTGG - Intergenic
1056786233 9:89594432-89594454 AAAGTGGTCCCAGCATTGTTAGG - Intergenic
1059330021 9:113528974-113528996 GATGAGGTTTCAGCATTCCTTGG + Intronic
1195306860 X:103592098-103592120 GATCAGGTACCAGCATGGTTGGG + Intergenic
1200125681 X:153813235-153813257 TATGAGGTCCATGCATTGTAAGG - Intronic