ID: 1149278270

View in Genome Browser
Species Human (GRCh38)
Location 17:55070526-55070548
Sequence TCAAGGGCATAGAAGGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149278270 Original CRISPR TCAAGGGCATAGAAGGCAAT TGG Intronic
902886076 1:19405851-19405873 TCAATTACATAAAAGGCAATGGG + Intronic
904111045 1:28126368-28126390 TCAAGGTCATGCAAGGCAAGTGG + Intergenic
905165708 1:36082006-36082028 GCAAGGGCTTGGTAGGCAATTGG - Intergenic
906194935 1:43924108-43924130 TCAAGGATATATAAGGCACTTGG + Intronic
906920986 1:50064154-50064176 GCAAGGGCATAGGTGGCAAGAGG + Intronic
909189981 1:72539404-72539426 TAAAGGACATAGTAGCCAATGGG - Intergenic
911536740 1:99108896-99108918 ACAAGGGGATAAAAGGCACTTGG + Intergenic
912254515 1:108045414-108045436 TCCAGGGCCCAGAAGGCAGTTGG - Intergenic
912652490 1:111451701-111451723 TGAAGGGCATACAAGGCAGAAGG + Intronic
913053818 1:115139453-115139475 TCAAAGGCATTAAAAGCAATTGG - Intergenic
913133893 1:115868619-115868641 TGAAAGGCATAGAAGACATTGGG + Intergenic
916840830 1:168598975-168598997 TCAAGGGAAGTGAAGGCAAAGGG - Intergenic
919098261 1:193062229-193062251 TCAGTGGTTTAGAAGGCAATTGG - Intronic
919209580 1:194462921-194462943 TCAGGGGCACATAAGGCATTTGG + Intergenic
920168754 1:204056009-204056031 TGAAGGCCATAGAAGGGCATAGG + Intergenic
920547727 1:206832435-206832457 TCATTCCCATAGAAGGCAATAGG + Intronic
1063294211 10:4786508-4786530 TCAAGGGCAGTGAAGGCAGGTGG + Intergenic
1063946053 10:11177627-11177649 TCAACAGCAAAGAAGGAAATAGG + Intronic
1064233874 10:13555359-13555381 TAAAGGGCATAGAATCCAGTTGG + Intergenic
1065261909 10:23932195-23932217 AGAAGGGCAAAGAAGGCATTTGG + Intronic
1068638660 10:59376645-59376667 TCAAGGGCAGAGATTGCAGTTGG - Intergenic
1069101252 10:64323719-64323741 TCTAGGGGATAGAAGAAAATAGG + Intergenic
1070756181 10:78994735-78994757 TCATTGGCATAAAAGGCAAATGG + Intergenic
1070841899 10:79493194-79493216 GCAAGGGCATAGTATACAATAGG + Intergenic
1072522011 10:96237325-96237347 TCCAGAGCAAAGAAGGCACTTGG - Intronic
1073319848 10:102608559-102608581 TCAGGGGCACAGAAGATAATGGG + Intronic
1073706385 10:105989142-105989164 TCAAGGCCAGAGAGGGCAGTGGG - Intergenic
1074559743 10:114524778-114524800 ACAAGGGCACAGAAGGAAAAGGG + Intronic
1077871826 11:6269498-6269520 TCAAGGGGTTAGAAGGCTAAAGG + Intronic
1079119869 11:17674183-17674205 CCCAGGGCATAGAACACAATGGG + Intergenic
1080295707 11:30724726-30724748 TCAGGGACATAGCAGGAAATAGG + Intergenic
1080496179 11:32822446-32822468 TCAAGGGCCTAGATAGCATTAGG - Intergenic
1084322200 11:68379654-68379676 TAAAAGGCATACAAGTCAATAGG - Intronic
1084725402 11:70938657-70938679 TAAAGAGCCCAGAAGGCAATGGG + Intronic
1087163217 11:94971928-94971950 TCATAGGAATAGAATGCAATAGG - Intronic
1088600449 11:111469759-111469781 TCAAGGGAAGAGAAGGCAAGGGG - Intronic
1090920639 11:131203468-131203490 TAAAGGGCATGGAAGGGCATGGG - Intergenic
1091317572 11:134625244-134625266 TCAAGGGCACAGAAAGAATTGGG + Intergenic
1092595428 12:9998782-9998804 TCGAGGGCATAGAAGTCAAGGGG - Intronic
1093286849 12:17274420-17274442 TGAAGGGCCTTGAAGGCCATTGG + Intergenic
1094372831 12:29756720-29756742 TCAATGGAATAGGAGCCAATAGG - Intronic
1096570323 12:52519353-52519375 TCCAGGGCACAGAAAGCACTAGG + Intronic
1098626780 12:72681443-72681465 TACAAGGCAAAGAAGGCAATAGG - Intergenic
1100168127 12:91941244-91941266 TGATGGGCTTAGAAGGGAATTGG - Intergenic
1102221185 12:111195490-111195512 TCAAGGGTACAGAATGAAATTGG + Intronic
1102959227 12:117081164-117081186 TCAAGGGCTTAGCAGCCACTTGG - Intronic
1103632136 12:122270015-122270037 TCAAAGGCATAGCACTCAATTGG + Intergenic
1104055468 12:125226897-125226919 CCAAGGGCCTAGAAAGCACTAGG - Intronic
1104582201 12:130019180-130019202 ACACGGGCATATAAGGGAATGGG - Intergenic
1112119630 13:96395784-96395806 CCTTGGGCATAGAAGGCACTAGG + Intronic
1113009703 13:105749875-105749897 TCAAAGGCATAGAAGGAATCAGG + Intergenic
1122179328 14:99944038-99944060 GCAAGGGCAAAGTAGGCATTCGG + Intergenic
1124556554 15:30731307-30731329 TCCAGAGCCTAGAAGGCAACGGG - Intronic
1124674724 15:31674431-31674453 TCCAGAGCCTAGAAGGCAACGGG + Intronic
1125265965 15:37881493-37881515 TAAAGGGGAGAGAATGCAATAGG - Intergenic
1134055832 16:11169254-11169276 TCAATGGCAAAGAAGCCACTGGG - Intronic
1134598178 16:15512413-15512435 CCCAGGACATAGAAGGCAGTTGG + Intronic
1139955440 16:70690876-70690898 TCCAGGGCATTGAAGGCTAGGGG + Intronic
1141542007 16:84731657-84731679 ACAAGGCTATGGAAGGCAATGGG - Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142319247 16:89370435-89370457 TCCAGGGCAAAGATGGCAAATGG + Intronic
1143220144 17:5254847-5254869 TCGAGGGCAGAGAAGGCTCTTGG + Intergenic
1143474702 17:7195984-7196006 ACCAGGGGCTAGAAGGCAATTGG + Intronic
1144368956 17:14571662-14571684 TCAAGGGCTCAGAAGAAAATAGG - Intergenic
1146689885 17:34866077-34866099 TCAAGGGCATAGATACCAAGGGG + Intergenic
1146721931 17:35129965-35129987 TCAAGGGCATTGAAAGAAATAGG + Intronic
1149278270 17:55070526-55070548 TCAAGGGCATAGAAGGCAATTGG + Intronic
1151440147 17:74123231-74123253 ACAAAGGCAAAGAAGGGAATAGG - Intergenic
1151700312 17:75739492-75739514 ACAAGGGCATAGAGGGGGATGGG - Intronic
1154141844 18:11831197-11831219 TCCAGGGCAGGAAAGGCAATGGG + Intronic
1157943977 18:51958254-51958276 TCAAGTGAAAAGAAGGCAAAAGG + Intergenic
1164161383 19:22627606-22627628 CCAAGAGCCTAGAAGGCAGTTGG - Intergenic
926699572 2:15794570-15794592 CCAAGGGCACAGAAGACAAGAGG - Intergenic
929146206 2:38708989-38709011 TCAGGAGCAGAGAAGGCAAATGG + Intronic
929758184 2:44785327-44785349 TCGGGGGCCAAGAAGGCAATGGG - Intergenic
929788319 2:45007341-45007363 TCAAAGGCATAGAAGGAGGTGGG - Intronic
930212986 2:48662527-48662549 TCAAGGGGATCCATGGCAATAGG + Intronic
931537925 2:63299271-63299293 TGAAGGGCATAGTAGCCAATGGG - Intronic
932866320 2:75346907-75346929 TAGAGGGCAGAGAAGGGAATGGG - Intergenic
934162866 2:89268996-89269018 TGAGGGGCATAGATGGCCATTGG - Intergenic
934204407 2:89913528-89913550 TGAGGGGCATAGATGGCCATTGG + Intergenic
937282066 2:120724852-120724874 TCAAGGGCATAAAAAGCAGTTGG - Intergenic
937631856 2:124110430-124110452 TCAAGAGCTTAGAATGAAATTGG + Intronic
941180146 2:162249714-162249736 TAAAGGGCAGAGAAGGCAGAGGG + Intergenic
941452190 2:165672880-165672902 TCAAGGGGATAGCAGGGAATAGG + Intronic
943314388 2:186368940-186368962 TCAAAGGCAAATAAGGGAATGGG + Intergenic
944097501 2:195985446-195985468 TCAGAGGCATTGAAAGCAATGGG + Intronic
945457095 2:210063204-210063226 GCAAGTGCATAGAAGTCAAGAGG + Intronic
949010781 2:241677179-241677201 CCAGGGGCGTAGAAGGCACTTGG + Intronic
1170232216 20:14062486-14062508 TCAAGGGGACAGAAGGGAAATGG + Intronic
1172297366 20:33822595-33822617 ACAAGGCCACAGAAGGCTATCGG - Intronic
1172937898 20:38633742-38633764 CCAAGGTCAGAGAAGGCAAGCGG - Intronic
1176872552 21:14095474-14095496 TCAGGAGCAGAGAAGGCAGTTGG + Intergenic
1178468329 21:32869401-32869423 TTAAAGGCATAGAAGGCACTAGG - Intergenic
1179503498 21:41824555-41824577 TCAACAGCATGGAAGGCACTTGG + Intronic
1181014322 22:20060599-20060621 TCATGGGCAAAGAAGGGAGTTGG - Intronic
951922464 3:27871414-27871436 TAGAGGGCATAGAAGGAATTTGG + Intergenic
955007219 3:54981147-54981169 CCAAGGACATACAAGACAATAGG + Intronic
960498652 3:118407928-118407950 TCAAGGGCATAGTAAACATTAGG - Intergenic
961025726 3:123554758-123554780 ACAAGGGCATATCAGGCAAATGG + Intronic
964553997 3:157915624-157915646 TTGAGGGCATAGAAGGTATTTGG - Intergenic
971417222 4:26442850-26442872 TCAAGGGTAAAGAAAGCGATGGG - Intergenic
973089314 4:46112747-46112769 TCATGAACATAAAAGGCAATGGG + Intronic
976342882 4:83964588-83964610 TCAGGGAAATAGAAGGCCATTGG - Intergenic
977531202 4:98202218-98202240 TTAATGGCATAGAAAGCCATTGG - Intergenic
982429620 4:155307871-155307893 TCAAGGGGAAATAAGGAAATGGG - Intergenic
983186318 4:164705155-164705177 TCAAGGAGAGAGAATGCAATTGG + Intergenic
984375702 4:178926051-178926073 TCAAGGGGATGGAAAGCATTAGG + Intergenic
986351628 5:6885512-6885534 AAAAGGGGTTAGAAGGCAATGGG + Intergenic
986984268 5:13482291-13482313 TAAAACTCATAGAAGGCAATAGG - Intergenic
989165302 5:38427828-38427850 TCAATAGCATAGCAGGAAATGGG + Intronic
989328699 5:40229833-40229855 TCAAGGGCATAAAAAGCAGGAGG - Intergenic
991220159 5:64205003-64205025 TCAGGGCTAAAGAAGGCAATTGG - Intronic
991312517 5:65259693-65259715 TCAATGGGAAACAAGGCAATGGG + Intronic
994123898 5:96149146-96149168 TGAAGAGCACAGAAGGGAATTGG + Intergenic
998066600 5:139164364-139164386 TCAAGTAGAGAGAAGGCAATGGG - Intronic
1000785917 5:165542985-165543007 TCAAAGGCAAAGAAAACAATTGG - Intergenic
1000867657 5:166535052-166535074 TCAAGGACAGAGAAAGGAATGGG + Intergenic
1001872070 5:175165285-175165307 CCAATGGCATAGGAGGCAAGAGG - Intergenic
1003625733 6:7739720-7739742 ACAAGGGCAGAGAAGACAGTGGG - Intronic
1004938761 6:20533744-20533766 TAAAGGTAATAGGAGGCAATAGG - Intergenic
1009539695 6:64938114-64938136 TCAAGGGGGAAGAAGGAAATGGG + Intronic
1013491686 6:110653217-110653239 TCAAGGGTATACAAGGCTATGGG + Intronic
1014574374 6:123052357-123052379 GCAAGTGCATAGAAGGAGATGGG + Intronic
1015849894 6:137560640-137560662 ACAAGGGCAGAGAAGGCAGCGGG - Intergenic
1018319021 6:162586888-162586910 TCACGGGCATGTAAGGCACTCGG - Intronic
1018357476 6:163033777-163033799 CCAAGGACATAGAAGACAAGAGG + Intronic
1020645955 7:10814477-10814499 ACAAGGCCACACAAGGCAATCGG + Intergenic
1020755731 7:12200844-12200866 TCAAGGTCAGAAGAGGCAATAGG + Intergenic
1022910710 7:34897675-34897697 TCAAGGGAGCAGAAGGCAAGTGG + Intergenic
1025043858 7:55673916-55673938 CCTAGGGCCTGGAAGGCAATTGG - Intergenic
1025136786 7:56422442-56422464 CCTAGGGCCTGGAAGGCAATTGG - Intergenic
1026386918 7:69858970-69858992 TCAAGTGAATAGAAGTGAATAGG + Intronic
1027536074 7:79403978-79404000 TCAAGGGCCAAGAAGATAATGGG + Intronic
1027753061 7:82176152-82176174 TGAAGGGCAGAGAAGGGTATAGG + Intronic
1030156266 7:106459182-106459204 CCAAGGGCATACAAGACAAGAGG + Intergenic
1031081627 7:117263862-117263884 TCAATGGCTTTGAAGGCCATTGG - Intergenic
1031689863 7:124774229-124774251 TCAAGGGCATTCAAGGAAAAAGG - Intergenic
1032286920 7:130545505-130545527 ACCAGGGCATAGATGGTAATAGG - Intronic
1033712636 7:143964415-143964437 TCAGAGGCATAGTAGACAATTGG - Intergenic
1039690162 8:39855147-39855169 AATAGGGCAGAGAAGGCAATCGG + Intergenic
1040765849 8:50910143-50910165 TCAAGGCCAAAGAATGCCATTGG - Intergenic
1042250761 8:66754000-66754022 TCAGGGGCCTAGAGGGCAATTGG - Intronic
1042852818 8:73233775-73233797 ACAAAGGAATAGAGGGCAATAGG - Intergenic
1045514283 8:102843322-102843344 TAAAAGGCATAGAAGGTAAAGGG + Intronic
1046116493 8:109790974-109790996 TCACGGGCATAGAAGGTAGAAGG + Intergenic
1046940320 8:119924841-119924863 TAATGAGCATAGTAGGCAATAGG + Intronic
1048655569 8:136531846-136531868 TCCAGTGTATTGAAGGCAATAGG - Intergenic
1048844392 8:138593228-138593250 TCAAGGGGACAGAGGGCATTAGG + Intronic
1051262094 9:15274584-15274606 TCAAAGGGAAAGAAAGCAATAGG + Intronic
1051883605 9:21865707-21865729 TCAAAGGCATAGCTGGCAACAGG - Exonic
1054820388 9:69515930-69515952 CCAAGGGCACACAAGGCCATGGG + Intronic
1056050234 9:82760931-82760953 TCAAGAGCCTAGAGGGCAACAGG - Intergenic
1056539608 9:87559962-87559984 TCAAGGGCAGAGGAGGGAAGAGG - Intronic
1059692637 9:116700055-116700077 TCAAGGGCATCAAAGCCAAATGG - Exonic
1062493309 9:136819368-136819390 TCAAAGGCATAGAAGGCTGGGGG + Intronic
1186596203 X:10984376-10984398 TGAAGGTCACAGCAGGCAATGGG + Intergenic
1187314020 X:18175007-18175029 TCAAGCACATAGCAGGCACTTGG + Intronic
1188458952 X:30400128-30400150 TCAAGGACATCAAAAGCAATTGG + Intergenic
1189294306 X:39908105-39908127 TCAAGGGCCTGGAAGACAAGGGG + Intergenic
1189500981 X:41558301-41558323 TCAAAGGCAAAGAAGGTAAGAGG + Intronic
1191005781 X:55710567-55710589 CCAAGGACATAAAAGGCAAGAGG + Intergenic
1197785266 X:130191829-130191851 TTAGGGGCATAGAAGTCAAGGGG - Intergenic
1198545819 X:137691849-137691871 TCTTGGGCATGGAAGGCACTCGG + Intergenic
1199656904 X:150005487-150005509 TCCAAGGCATAGATGGAAATTGG + Intergenic