ID: 1149279448

View in Genome Browser
Species Human (GRCh38)
Location 17:55086190-55086212
Sequence ATACTCAGTAATTTCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149279448 Original CRISPR ATACTCAGTAATTTCCAGGC TGG Intronic
902064408 1:13672260-13672282 CAAATCAGTAATTTTCAGGCTGG - Intergenic
902637088 1:17741638-17741660 ATATTCAATAATTTCCAAGCTGG - Intergenic
905536228 1:38724093-38724115 ATACTCAGAAAACTCCAGACAGG + Intergenic
906618462 1:47253111-47253133 CGACTCAGTAATTAGCAGGCTGG - Intronic
906829629 1:49017778-49017800 ATACACAGTAACTTCCAGAGAGG + Intronic
907610333 1:55863111-55863133 ATACTCAAGAATGACCAGGCAGG + Intergenic
909227385 1:73043111-73043133 ATAATCAGTAATTGTTAGGCAGG + Intergenic
909344197 1:74566486-74566508 TTACCCAGTCATTTCCAGGAAGG + Intergenic
909872571 1:80761414-80761436 ATACTCACTCATTTCCTGGAAGG + Intergenic
910047026 1:82930159-82930181 GTACTCAGTAATTCCTAGGGTGG + Intergenic
910636960 1:89419068-89419090 ATGGTCAGTGATTTCCAGGATGG - Intergenic
911873773 1:103132936-103132958 ATACCCAGTAATTGCACGGCTGG + Intergenic
913338984 1:117738100-117738122 ATATTCAGTTATTTTTAGGCAGG + Intergenic
920277401 1:204816920-204816942 ATAATCAGTAAACTCCAGCCTGG - Intergenic
923227263 1:231949601-231949623 CTACGCAGTGTTTTCCAGGCTGG - Intronic
1063185222 10:3644431-3644453 ATTCTCAGTAATAACCAGGAGGG - Intergenic
1063546950 10:6990749-6990771 ATACTCTGTAATGTGCAGCCGGG - Intergenic
1064235634 10:13571733-13571755 ATACTTACTAATTTCCAGCCTGG + Intergenic
1065136366 10:22674644-22674666 TTACTAAGAAATTTCCAGCCAGG + Intronic
1065292759 10:24247498-24247520 CTACACATTAATTTCCAGGCTGG + Intronic
1067718414 10:48707730-48707752 ATACTCTGTAAGTTCCATGCTGG + Intronic
1070654539 10:78262334-78262356 CTACTCAGTAGTTCCTAGGCAGG + Intergenic
1070919538 10:80175491-80175513 ATACCAAGTAAATTCCAGCCAGG + Intronic
1074328888 10:112483057-112483079 ATACCCAGTATCTTCCAGGAGGG + Intronic
1076548474 10:131261776-131261798 ATTTTCTGTACTTTCCAGGCCGG + Intronic
1078373632 11:10773970-10773992 ATAGTCAGTTATTTCCTGGTTGG - Intronic
1078550243 11:12275303-12275325 AGAATCAGGAATGTCCAGGCTGG + Intergenic
1083164095 11:60873002-60873024 ATACTCAGCATTTCCAAGGCAGG - Intronic
1083983534 11:66193864-66193886 CTACTCAGAAATTACTAGGCTGG + Intronic
1085680670 11:78571896-78571918 ATCAACAGTAATTTCCAGGTTGG + Intronic
1086512917 11:87579445-87579467 ATATTTATTAAATTCCAGGCAGG - Intergenic
1088950511 11:114564931-114564953 ATAATGAATACTTTCCAGGCAGG + Intergenic
1094574387 12:31670684-31670706 ATACCCAGTAATACCCAGCCTGG - Exonic
1098367049 12:69714672-69714694 AAACTCAGTAATTTCTAGGGTGG + Intergenic
1099502995 12:83436684-83436706 ATACTCAGTAATGTGATGGCTGG + Intergenic
1100769198 12:97902435-97902457 ATACTCAATGATTTCAAGGTAGG - Intergenic
1102086337 12:110143949-110143971 ATATTTAGTAATTCCAAGGCAGG - Intronic
1102912237 12:116725587-116725609 ATACTTAGTACTTTTCTGGCCGG + Intronic
1105434695 13:20366295-20366317 CTGCTCAGTTATTTCCAGGATGG + Intergenic
1107224933 13:38037844-38037866 ATAATCAGAATTTTACAGGCAGG - Intergenic
1107788592 13:43978400-43978422 AACCTCAGTAATTTCCAGAAAGG - Intergenic
1109367413 13:61373543-61373565 ATAATTAGGAAATTCCAGGCTGG - Intergenic
1110995972 13:82110240-82110262 AAACTATGTAATTTACAGGCAGG + Intergenic
1111811485 13:93097253-93097275 AGCCTCAGTAATCTCCAGGGTGG - Intergenic
1112777391 13:102860049-102860071 CTACTCAGTGATTAACAGGCAGG - Intronic
1112912914 13:104510574-104510596 CTAGTCAGAAAGTTCCAGGCAGG - Intergenic
1113645843 13:111995006-111995028 ATACTCAGAAACTTCAACGCTGG - Intergenic
1116255924 14:42555149-42555171 ATATTCTATAATTTCCAGGTAGG + Intergenic
1116453903 14:45095511-45095533 ATCCTCAGGATTTTACAGGCTGG + Exonic
1118054985 14:62070407-62070429 TTACCCAGTAATTTTCATGCAGG - Intronic
1119002203 14:70892625-70892647 AAACCCAGTATTTTCCAGGGAGG - Intergenic
1120800065 14:88677922-88677944 ATACTCAGTAATTACATTGCTGG - Intronic
1122043560 14:99007583-99007605 AGGCTCAGTAATAGCCAGGCAGG - Intergenic
1126325027 15:47467312-47467334 ATCCACAGTGATTTCCAGGGTGG - Intronic
1126391467 15:48159644-48159666 GTCATCAGTAATTTGCAGGCCGG - Exonic
1127264107 15:57347283-57347305 ATACACAGTATTTTCAAGGCAGG - Intergenic
1130818780 15:87469218-87469240 ATACTCAGTAATTGGATGGCTGG - Intergenic
1131337421 15:91562595-91562617 ACACTCAGTCTTTTCCAGGGAGG + Intergenic
1134032776 16:11005919-11005941 ATATTCAGAAATTTCCAGACAGG - Intronic
1137767581 16:50990063-50990085 ATACTGAGTTAGTGCCAGGCAGG + Intergenic
1142217760 16:88838199-88838221 AGACCCAGTAATTACCTGGCAGG - Intronic
1148736415 17:49867730-49867752 ATGCTCAGTATTACCCAGGCAGG + Intergenic
1149228919 17:54509443-54509465 AGAATCAGTAATGTCCAGGGTGG - Intergenic
1149279448 17:55086190-55086212 ATACTCAGTAATTTCCAGGCTGG + Intronic
1150493111 17:65587844-65587866 ATACTAAGTACTTCCCAAGCAGG - Intronic
1155104387 18:22647343-22647365 ATACTCAGTAATTTTTGGGGGGG - Intergenic
1155255361 18:23992634-23992656 CTACTGAGTAATTGGCAGGCAGG + Intergenic
1155612610 18:27683894-27683916 ATACTTGGTAATTTCCAGTTTGG + Intergenic
1155683561 18:28519867-28519889 AGACTCAGAAATTTGCAGGCAGG + Intergenic
1156377829 18:36530775-36530797 ATACTGTGTATTTTCCAGCCCGG + Intronic
1156427036 18:37024887-37024909 ATACTCAGTAATGTGATGGCTGG + Intronic
1157116901 18:44870490-44870512 AAACTCACTACTTTCCAGACAGG - Intronic
1157632386 18:49111771-49111793 TTACTCAGTACTTGCTAGGCTGG + Intronic
1158406622 18:57165558-57165580 ATACTCTGTAGGTTGCAGGCTGG + Intergenic
1160332957 18:78012148-78012170 ATATTCAGTTCTTTACAGGCAGG - Intergenic
1161443227 19:4304318-4304340 ATTTTCAGTAAATGCCAGGCGGG + Intergenic
1168037922 19:53735078-53735100 AAAATCTGTATTTTCCAGGCTGG + Intergenic
926439364 2:12871718-12871740 ATATTCAGAAATATACAGGCTGG + Intergenic
926487700 2:13483084-13483106 ATGCTAAGTGGTTTCCAGGCGGG + Intergenic
929677702 2:43953877-43953899 ATACTCAATAATGGCCAGGCCGG + Intronic
932899809 2:75684686-75684708 ATACTCAGTAATAGCATGGCTGG - Intronic
935870359 2:107441389-107441411 ACACTCAGTTATGTCTAGGCAGG + Intergenic
937775553 2:125771191-125771213 TCACTCAGTACTCTCCAGGCAGG - Intergenic
938762009 2:134434477-134434499 ATAAACAGTAATTTCCAATCTGG - Intronic
939289736 2:140178571-140178593 AACCTCAGTAATTTCCGTGCTGG - Intergenic
941172583 2:162157595-162157617 ATACTGAGTAAGTTTCAGGCAGG - Intergenic
941247756 2:163122005-163122027 CTACTCAGTAATTGCCAGACAGG + Intergenic
944120504 2:196235477-196235499 ATAGTCAGAAATTTACAGGATGG - Intronic
945623014 2:212166259-212166281 ATCCTCAGTGATTTCCAGACTGG - Intronic
947519614 2:230834579-230834601 ATAAATAATAATTTCCAGGCTGG + Intergenic
1171400352 20:24869050-24869072 AGACTCAGGCATTTTCAGGCTGG - Intergenic
1172403758 20:34672235-34672257 ATACATATAAATTTCCAGGCCGG - Intronic
1172580665 20:36044749-36044771 ATAATCAAGCATTTCCAGGCTGG - Intergenic
1173538316 20:43832436-43832458 GAACTCAGTAATTTTCAGGCTGG - Intergenic
1177396309 21:20539772-20539794 ATACTCTAAAATGTCCAGGCCGG + Intergenic
1183011004 22:34946533-34946555 ATATTCTGTGACTTCCAGGCTGG + Intergenic
1183717698 22:39543502-39543524 ACACTCAGTAATTCCCAAGAGGG - Intergenic
1183752345 22:39728725-39728747 ACAGTCAGTCAGTTCCAGGCTGG + Intergenic
950385655 3:12657466-12657488 ATTCTTAAGAATTTCCAGGCAGG + Intronic
952203747 3:31158258-31158280 AAGCTCAGTCATTTCCAGGGAGG + Intergenic
958119506 3:89265987-89266009 TTACTCAGGATTTTCCAGTCTGG + Intronic
958508754 3:95017099-95017121 ATACTGAGTAATGGCAAGGCTGG - Intergenic
962497078 3:135950827-135950849 ATCCTCCGTAATTTCCAGTTTGG - Intergenic
964670859 3:159224737-159224759 ACACTCAGTAAAATCCAGACTGG + Intronic
967664650 3:192156167-192156189 ATAAGCAGTAATTTCTAGACTGG + Intronic
971414800 4:26414463-26414485 ATAAACAGGAATATCCAGGCTGG - Intronic
972089756 4:35266454-35266476 TTACTGAGTAAATTCAAGGCAGG + Intergenic
972242334 4:37206642-37206664 ATACTTATTAAATGCCAGGCAGG + Intergenic
972369804 4:38412341-38412363 ATAGTCAGTGCTTTCCTGGCTGG + Intergenic
972520939 4:39855978-39856000 AAACTCAGTGATCTCCAAGCAGG + Intronic
974530611 4:63102526-63102548 ATACTCAGTAATTGGATGGCTGG - Intergenic
976506819 4:85856763-85856785 ATTTTAAGTAATTTCCAGCCGGG - Intronic
982476286 4:155855305-155855327 ACACTCACTATATTCCAGGCAGG - Intronic
982560292 4:156921355-156921377 ATTCTCAGTATTTTTGAGGCTGG - Intronic
983255739 4:165398111-165398133 ATACTAAATAATTTAGAGGCTGG + Intronic
984347205 4:178543861-178543883 ATGCTCAGGAGTTTCCAGCCAGG - Intergenic
985166603 4:187101861-187101883 ATATTCAGTAATTTGCAGTGGGG + Intergenic
986118605 5:4806513-4806535 CTACTCAGTAATTTCAAAGAGGG - Intergenic
988252325 5:28775577-28775599 ATGCTCAGTAAATAGCAGGCTGG + Intergenic
989700683 5:44261008-44261030 TTAATCAATAAGTTCCAGGCTGG - Intergenic
991502655 5:67292419-67292441 ATACTCAGTAATTCCCCTGCTGG - Intergenic
992695311 5:79280136-79280158 AGAAACAGGAATTTCCAGGCTGG - Intronic
995024961 5:107409451-107409473 ATACTCAGTAGTTTCTCGTCTGG - Intronic
998054607 5:139063547-139063569 TGACTCAGTAATTTCCAAGTGGG - Intronic
1000143844 5:158433541-158433563 ATTCTCAGTAAATTGCAGCCAGG - Intergenic
1000357979 5:160419145-160419167 ATGCGCACTAATTTCCTGGCGGG + Exonic
1007912603 6:45531028-45531050 ATACTCAGTAGTTTGCCAGCAGG + Intronic
1008701083 6:54100888-54100910 ACACTCAGTAATTTTCATCCTGG - Intronic
1011639064 6:89402340-89402362 ATCCTTAGTGATTTCCAGGCCGG - Intronic
1011792428 6:90912984-90913006 AGACTACGTAATTTGCAGGCAGG - Intergenic
1011953181 6:92993350-92993372 ATACTAAGTAATTGCCATGTGGG - Intergenic
1015454688 6:133413162-133413184 AAACAGAATAATTTCCAGGCAGG - Intronic
1017837649 6:158193696-158193718 ATTCTTAAGAATTTCCAGGCTGG + Exonic
1018456206 6:163955148-163955170 ATACTCTGAAAATTCCATGCTGG + Intergenic
1020506811 7:9000881-9000903 ATAACCAGTATTTTCCTGGCTGG - Intergenic
1020897420 7:13958258-13958280 ATTCTCAGAAATTTCCAGGTTGG + Intronic
1021062396 7:16130241-16130263 ATACTGGATATTTTCCAGGCAGG + Intronic
1022833195 7:34088647-34088669 ATACACAGTAACTACCTGGCAGG + Intronic
1030181905 7:106718639-106718661 ATGCTCAGTAATTTCCTCCCTGG - Intergenic
1033055246 7:138046744-138046766 AGACTCAGTTATATCCAGCCAGG - Intronic
1034999778 7:155603529-155603551 ATAGTGAGCAATTTCCTGGCTGG - Intergenic
1035413639 7:158666392-158666414 ATCCTCAGGCATTTCCAGACAGG - Intronic
1036147615 8:6269362-6269384 AGTCTCACTGATTTCCAGGCTGG - Intergenic
1039523273 8:38190630-38190652 AGTCTCATTATTTTCCAGGCTGG + Intronic
1041084683 8:54245903-54245925 GTCCTCAGCAAATTCCAGGCAGG - Intergenic
1041341676 8:56852775-56852797 ATACTCAGTAATGTGATGGCTGG + Intergenic
1041575482 8:59390137-59390159 AAGCTCAGGAATTTCCAGGGTGG - Intergenic
1042769354 8:72362644-72362666 TGACTCAGTTATTCCCAGGCAGG + Intergenic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1045788994 8:105958922-105958944 ATACTCAGTAATGGCATGGCTGG - Intergenic
1046787624 8:118285057-118285079 ATACTCTGTTATATCCAGGCAGG + Intronic
1046899363 8:119507403-119507425 ATCCACAGTATTTTTCAGGCAGG + Intergenic
1046990492 8:120447371-120447393 ATACTCATTAATTTTCAAGTTGG + Intronic
1048763081 8:137818186-137818208 ATACTCAGTAATGTGATGGCTGG - Intergenic
1050656433 9:7833579-7833601 ATACTCTGTAAATTCCAGGATGG - Intronic
1052593016 9:30522764-30522786 ATACTCTGGACCTTCCAGGCTGG + Intergenic
1052844732 9:33325147-33325169 AAACTCAGTAAACTCCAGGTAGG + Intronic
1053552426 9:39097948-39097970 GTACTCTGGCATTTCCAGGCTGG - Intronic
1053816547 9:41918112-41918134 GTACTCTGGCATTTCCAGGCTGG - Intronic
1054106810 9:61061794-61061816 GTACTCTGGCATTTCCAGGCTGG - Intergenic
1054614047 9:67269331-67269353 GTACTCTGGCATTTCCAGGCTGG + Intergenic
1055694899 9:78873312-78873334 AGACTCAAAAATTTCCAGGCTGG + Intergenic
1057043901 9:91869251-91869273 AGTCTCAATAAATTCCAGGCTGG + Intronic
1059745088 9:117192409-117192431 ATTCTGAATACTTTCCAGGCTGG + Intronic
1059924550 9:119195231-119195253 ATACTCACTAAGTGCCAGGCGGG - Intronic
1060216511 9:121741643-121741665 ACCCTCAGTGATTTCCAGGCAGG - Intronic
1187207957 X:17200889-17200911 ATACTCCTTAATTTCCAGCTTGG + Intergenic
1189501780 X:41567720-41567742 ATACTCAGTAATGACATGGCTGG - Intronic
1192312624 X:70029279-70029301 ATACTCAGAAGTTTCCCTGCTGG + Intronic
1192807338 X:74522421-74522443 GTGCTGAGTAGTTTCCAGGCAGG - Intronic
1194752811 X:97703786-97703808 GTACTCAGTAGCTTCCAGCCTGG + Intergenic
1194840693 X:98737537-98737559 ATACCCAATAATTTGAAGGCAGG + Intergenic
1195483810 X:105379311-105379333 ATTCTGAGTAATATCCAGGATGG - Intronic
1195724856 X:107903936-107903958 ATACTCTGAAATTTCTTGGCAGG + Exonic
1198262858 X:134981822-134981844 ATACTCTGTAATTTATAGACTGG + Intergenic
1199734861 X:150676373-150676395 TTAACCAGTAATTTCCAAGCAGG + Intergenic
1201691258 Y:16767700-16767722 ATACGCAGTAATTTGATGGCTGG - Intergenic