ID: 1149281792

View in Genome Browser
Species Human (GRCh38)
Location 17:55112975-55112997
Sequence GAAGAGAAATTTCAGTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149281792 Original CRISPR GAAGAGAAATTTCAGTAGAT TGG Intronic
900750937 1:4397040-4397062 GAAGAGAAGTTACATAAGATTGG + Intergenic
906903010 1:49857776-49857798 GAAGAAACACTTCAGTAGATTGG + Intronic
908126543 1:61036705-61036727 GAAAAAAATTTTCAGAAGATTGG + Intronic
908397839 1:63742605-63742627 GAAGAGACATTTCATGAGAAAGG + Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
908884493 1:68772539-68772561 GGTGAGAAATCTCAGTAAATGGG - Intergenic
909657172 1:78045175-78045197 TAAGTGAAATTTCAGTAGTGTGG + Intronic
909774887 1:79471395-79471417 GAAGAAAAATTTCAATAAAACGG - Intergenic
910122951 1:83810480-83810502 GAGGAGAAATTTCATTAAAGAGG - Intergenic
910234575 1:85022624-85022646 GAAGAGAAAATTCAGAGGAGGGG + Intronic
911289267 1:96036722-96036744 GAAGAGTGATTTCACTAGAGAGG + Intergenic
911534285 1:99081152-99081174 GAAGAGACATTTCACTAAAGGGG + Intergenic
914665608 1:149829936-149829958 GAAAACAAAATTCAGTGGATGGG + Intergenic
914670157 1:149863858-149863880 GAAAACAAAATTCAGTGGATGGG - Intronic
914886162 1:151586101-151586123 GAAGAGAAATTCCAGCAGAAAGG - Intergenic
915711119 1:157898910-157898932 GAAGAGATATTTCAGCAAAGAGG - Intergenic
915908293 1:159895772-159895794 GAATAGAAACTTCAGTAGGTGGG + Intronic
916097236 1:161362284-161362306 AAAAAGGAATTTCAGTAAATAGG - Intronic
916603778 1:166321241-166321263 TAAGGGAAATTACAGTAAATAGG + Intergenic
916863042 1:168826699-168826721 AAAGAGGAAATTCAGTAAATAGG + Intergenic
918253591 1:182726688-182726710 GCACAGAAATTACAGTAGAGTGG - Intergenic
918797701 1:188924745-188924767 GAAGAGACAATTCACAAGATGGG + Intergenic
919549980 1:198973526-198973548 GAAGTGAAATTTGAATAGATGGG + Intergenic
920857975 1:209678481-209678503 GAACAGAGATTTCAATAGCTCGG - Intergenic
921002808 1:211061754-211061776 GTAGAGAAATTTCACTTGTTTGG - Intronic
923371079 1:233313450-233313472 GAAAATAATTTTCAGTAAATGGG + Intergenic
923984182 1:239361897-239361919 GAAGAAAAATATTAGTAGTTTGG - Intergenic
924452716 1:244192739-244192761 GAAGAGTGATTCCAGAAGATTGG + Intergenic
1063143939 10:3279568-3279590 GAAGAGACATTTCACTAAAAAGG + Intergenic
1063931293 10:11030858-11030880 TAAGAGACATGTCAGTGGATGGG + Intronic
1064066068 10:12182584-12182606 GAATATCTATTTCAGTAGATTGG - Intronic
1064540481 10:16399932-16399954 GAGGAGAAAAATCAGTAAATAGG + Intergenic
1064567860 10:16660987-16661009 CAATTAAAATTTCAGTAGATAGG - Intronic
1065287905 10:24202878-24202900 GAAGAGGAATTTTAGAAAATAGG + Intronic
1065490242 10:26275228-26275250 GAAGAGAAAGTACTGTACATAGG - Intronic
1065856789 10:29837811-29837833 TGAGAGCAATTACAGTAGATGGG + Intergenic
1066162485 10:32748553-32748575 GAAAAGAAACTCCAGTAAATGGG + Intronic
1066637635 10:37522113-37522135 GTAGAGAAAACTCAGTAAATAGG - Intergenic
1066809139 10:39302705-39302727 GAAAAGAATTTTCAGCAGTTTGG - Intergenic
1067013177 10:42733438-42733460 GATGAGAAAATTCTGCAGATTGG - Intergenic
1067373239 10:45704195-45704217 GATGAGAAAGTTCCGGAGATTGG + Intergenic
1067386537 10:45821927-45821949 GATGAGAAAGTTCCGGAGATTGG - Intergenic
1067636770 10:48006194-48006216 GATGAGAAAGTTCCGGAGATTGG - Intergenic
1067876718 10:50014148-50014170 GATGAGAAAGTTCCGGAGATTGG + Intergenic
1068167403 10:53349034-53349056 GAAGAGACATTTCACCAGAGAGG + Intergenic
1068949976 10:62767080-62767102 GAAGCAAAGTTTCAGGAGATGGG + Intergenic
1069024779 10:63527795-63527817 GAAGGGCAATTTCAGTGGAGTGG - Intronic
1069150919 10:64958675-64958697 TAAGAAAAATTTCAGTAAGTTGG + Intergenic
1071238545 10:83678120-83678142 TGAGAGAAATTTCAGAAGAAAGG - Intergenic
1074696526 10:116054537-116054559 GATGATAAATTTCTATAGATAGG - Intergenic
1074714397 10:116204814-116204836 GAAGAATAATTTATGTAGATAGG + Intronic
1075510253 10:123066748-123066770 AAAGAGAAATTTCCCTAGGTTGG + Intergenic
1075602041 10:123777015-123777037 GAAAAGAAATTCCAGAAGAAGGG + Intronic
1078646859 11:13148607-13148629 GAAGAGAAATTTTGGTATGTGGG - Intergenic
1078971972 11:16424718-16424740 AAAGAGAAATATCTATAGATAGG + Intronic
1079638942 11:22780177-22780199 GAAAAGTAATTTCACTAGCTAGG + Intronic
1081682815 11:45020459-45020481 CAAGGGAAATTTCAGGACATTGG + Intergenic
1081886107 11:46497893-46497915 GAAAAGAAATTTCAATGCATGGG + Intronic
1081954368 11:47076889-47076911 GAAAGAAAAATTCAGTAGATGGG + Intronic
1083536168 11:63468587-63468609 GAAGAGAAATTTCTTTAGCTTGG - Intronic
1085568647 11:77539675-77539697 CAAAAGCAATTTCAGTAGAAAGG + Intronic
1085959319 11:81441781-81441803 AAATAGAAATTTCTGTTGATAGG - Intergenic
1086482044 11:87251977-87251999 CTAGAGAAATTTCTGTAGGTGGG + Intronic
1086801324 11:91179959-91179981 TAAGAGAAGTGTCAGTAGCTTGG + Intergenic
1086803929 11:91215714-91215736 GAAGAGAAAATTTGGTAAATTGG + Intergenic
1086876637 11:92104427-92104449 GAAGAGAGATTTCAATAAATTGG + Intergenic
1086962680 11:92995803-92995825 GAAGAAAAAATTCTGGAGATTGG + Intergenic
1087211359 11:95448606-95448628 GAACACAGATTTCAGTAGCTGGG + Intergenic
1087624538 11:100581817-100581839 GAAGAGAAAATTCAGGAGAGAGG - Intergenic
1088343690 11:108798378-108798400 GACGAAAAATTTCTGGAGATTGG - Intronic
1088364139 11:109021158-109021180 GAAGAGCAATCTCAGCAGAGGGG - Intergenic
1088906550 11:114159459-114159481 GAATAGAAATATCAGAATATAGG - Intronic
1089314434 11:117581918-117581940 GAAGTGAATTTTGAGGAGATAGG - Intronic
1090469577 11:126968405-126968427 GAAGAGCAATTTCAATCAATGGG + Intronic
1090963234 11:131575359-131575381 GAAGAGAAATTAAAATATATAGG - Intronic
1091425502 12:384741-384763 GATCAGAAAATTCAGTAGATCGG + Intronic
1091782575 12:3223177-3223199 GCAGAGTAATTGCAGTACATGGG + Intronic
1093227603 12:16504333-16504355 GAAGAGAAATTACAGAAAAGTGG - Intronic
1093714081 12:22361814-22361836 GAATAAAAATATCAGTGGATGGG + Intronic
1095609002 12:44105540-44105562 TAAGAGAAACTGCAGTAAATCGG + Intronic
1095683806 12:45009454-45009476 TAAGATAAATTCCAGTAAATGGG + Intergenic
1098045727 12:66398375-66398397 GAAGAGAGAATTTAGCAGATTGG - Intronic
1098608359 12:72422692-72422714 GAAGATAAATTTACTTAGATTGG + Intronic
1098846881 12:75547997-75548019 GAAGAGAATTGTCAGGAGATAGG + Intergenic
1099019285 12:77383157-77383179 GAAACGAATTTTCAGCAGATGGG + Intergenic
1099879267 12:88447400-88447422 GAACAGAAATTTTAAAAGATTGG + Intergenic
1100931518 12:99615417-99615439 TCAGAGAAATTTCAGTACTTTGG - Intronic
1101730263 12:107421018-107421040 GTAGAGAGGTTTCAGTAGAGAGG + Intronic
1102181434 12:110915561-110915583 TAAGACAAATTTCAGGGGATGGG - Intronic
1103189521 12:118989242-118989264 GAACAGCAATATCAGAAGATTGG + Intronic
1103505106 12:121437513-121437535 AAAAAGAAATTGCAGTATATGGG + Intronic
1105994577 13:25658054-25658076 GTAGAAAGATTTGAGTAGATTGG + Intronic
1106976366 13:35221511-35221533 GAAAAGAAATATAAGTAGACAGG - Intronic
1107025212 13:35794836-35794858 AAAGTGAAATTCCAGTAGAGTGG + Intronic
1108107490 13:47027426-47027448 AAAGAAAAATTGCAGTAGATAGG + Intergenic
1108238509 13:48435364-48435386 GAAGAGAAATTTCACCAGAGAGG - Intronic
1109156965 13:58923383-58923405 TGAGAGAAAATTCAGTAGATTGG - Intergenic
1109368007 13:61382862-61382884 GAAGAGCAATTTAAGTAGTGTGG - Intergenic
1110873755 13:80484245-80484267 GAACAGCAATTACAGTATATAGG - Intergenic
1111840069 13:93438856-93438878 GAAGAGAAGATTCAATTGATAGG + Intronic
1112078765 13:95943017-95943039 GAAGTGACATTACAGTAAATGGG - Intronic
1112373904 13:98821068-98821090 ACAAAGAAATTTCAGCAGATAGG + Intronic
1113382535 13:109817105-109817127 GAAGAGGAATTAAAGGAGATTGG + Intergenic
1115375923 14:32675193-32675215 GAAGAGCAATTCAAGTGGATGGG - Intronic
1116402340 14:44523195-44523217 TAAGAGCAACTTCAGTAGAAGGG + Intergenic
1118154785 14:63228998-63229020 GAAGAGACACCTCAGTAAATAGG - Intronic
1120632814 14:86911534-86911556 GAAGAGAAATCATAGAAGATAGG + Intronic
1120653552 14:87162507-87162529 GAAAAGAAATTTTAATTGATAGG + Intergenic
1123451469 15:20365271-20365293 AAAGAGACATTTCAGTGAATAGG + Intergenic
1123722866 15:23075064-23075086 GAATAGAAACATCAGGAGATAGG - Intergenic
1124802326 15:32845770-32845792 GAAGGAAATTTTCAGTATATTGG + Intronic
1124848367 15:33312312-33312334 GAAGAGAAACTGAAGTAAATTGG - Intronic
1125139738 15:36390859-36390881 GAATATAATTTTCAGTAGAGAGG - Intergenic
1125172663 15:36783828-36783850 TAAGAGACATTTCAGAATATTGG + Intronic
1125172844 15:36785910-36785932 TAAGAGACATTTCAGAATATTGG + Intronic
1127160170 15:56174331-56174353 GAAGAGAAAATTTATTAGATGGG + Intronic
1127447801 15:59083217-59083239 GAAGAGAAAATACAGTAAACTGG + Intronic
1128280950 15:66393851-66393873 GAAGAGACATTTCAACAGAGGGG - Intronic
1130914481 15:88294106-88294128 GGCGAGAGATTTCAGTAGAAAGG - Intergenic
1131883902 15:96888528-96888550 GAAGAGAAATCTGGGGAGATAGG + Intergenic
1133509054 16:6440301-6440323 GAAGAGAAAATAAAGAAGATGGG + Intronic
1134611103 16:15608655-15608677 GATGAAAAAGTTCAGAAGATCGG + Intronic
1135477670 16:22791635-22791657 GAAGAGACATTTCAACAGAAAGG + Intergenic
1135576435 16:23589591-23589613 GAAAAGAAATTTCAGTTGGAGGG + Intronic
1135869254 16:26134315-26134337 GAAAAGAAAATTCAGTTGAGAGG - Intronic
1137227615 16:46529859-46529881 GAAGAGAAATAACACTGGATTGG - Intergenic
1137254046 16:46760631-46760653 GAAGAGAAAGTTCTTTTGATGGG - Intronic
1137338814 16:47578110-47578132 AAATAAAAAGTTCAGTAGATAGG - Intronic
1137458971 16:48640542-48640564 GAAGAGAAAATACAGGAGAATGG + Intergenic
1139222480 16:65197953-65197975 GAAGGGAATTTTCAGTAGATGGG - Intergenic
1139768912 16:69256421-69256443 GAAGAAAAATTTCTGGACATTGG - Intronic
1140175849 16:72658881-72658903 GAAGAGAAACTTCTGTACAGAGG - Intergenic
1142516513 17:433687-433709 GGAGAGCATTTTCAGTAAATGGG - Intergenic
1144247288 17:13379615-13379637 GAAGCCAAATATCAGTTGATTGG + Intergenic
1145753412 17:27372077-27372099 GAGGAAAAAATTCACTAGATGGG - Intergenic
1146665167 17:34696446-34696468 GAAGAGATAATTTAGTAGACTGG + Intergenic
1147488904 17:40845394-40845416 GAGGAGAATTTTGAGAAGATGGG + Intergenic
1147871249 17:43589096-43589118 GATGAGGAATTTCATCAGATAGG - Intergenic
1147917195 17:43895880-43895902 GAAGAGAAAACTGAGCAGATTGG - Intronic
1148128776 17:45250229-45250251 GAAAAGAAAACTCAGTGGATTGG - Intergenic
1149096917 17:52854098-52854120 GAAGAGAAATCTCTGTAAAAAGG + Intergenic
1149195524 17:54115260-54115282 GAAGAGAACTTTCAGGATAATGG + Intergenic
1149281792 17:55112975-55112997 GAAGAGAAATTTCAGTAGATTGG + Intronic
1150702297 17:67458417-67458439 GAAGAGAGAATTCAGTAAAATGG - Intronic
1151452425 17:74206484-74206506 GAAGATAAAGTTCTGGAGATGGG - Intronic
1152620305 17:81360510-81360532 GAACAGACATTTCACTAGAGAGG - Intergenic
1155567928 18:27157932-27157954 GAAGAGAATTTCCAGTAAAATGG + Intronic
1156169765 18:34468524-34468546 TCAGATAAATTTCAGTAGAAAGG - Intergenic
1156184728 18:34648512-34648534 AAAGGGAAATTGGAGTAGATGGG + Intronic
1156239833 18:35242567-35242589 GATGAGAAATTTAAGCAGAATGG + Exonic
1156688781 18:39681367-39681389 GCAGAGAAATTTCAGGAGAAAGG + Intergenic
1156982270 18:43304593-43304615 CAACAGAAATTCCAGTAGTTGGG - Intergenic
1156984600 18:43334546-43334568 CAAGAGAAAATTCACTAAATAGG - Intergenic
1159011873 18:63065679-63065701 GAAGAGAACTCTCCCTAGATTGG + Intergenic
1159238083 18:65703559-65703581 AAAAACAAATTCCAGTAGATGGG + Intergenic
1159243311 18:65771919-65771941 GAAGAGTAATTTCTCAAGATGGG + Intronic
1159792947 18:72806535-72806557 GATGAGAAAATCCAGAAGATAGG - Intronic
1162133041 19:8538903-8538925 GATGAGAAAGTTCTGGAGATGGG + Intronic
1164808301 19:31135863-31135885 GAACAGACATTTCACTAGAGAGG + Intergenic
1165252255 19:34549090-34549112 GGAGATAAATTGCAGTAGAGAGG + Intergenic
1165395067 19:35559426-35559448 GAAGAGAATTTTCAGAACCTCGG - Intronic
1165558021 19:36652940-36652962 GGAGAGACATTTCACTAAATAGG + Intronic
925403055 2:3589469-3589491 GAAGAGACATTTCACTAAAGAGG - Intergenic
926485512 2:13451044-13451066 AAAGAGACATTTCAGTGAATAGG - Intergenic
926657024 2:15419256-15419278 GATGAGAAATTTGAGTAAAGAGG + Intronic
927144815 2:20156277-20156299 CAAGAGCAGTTTCAGTAGAGTGG + Intergenic
928047584 2:27952898-27952920 GAAGAAAGATTTCAATAAATTGG - Intronic
928065826 2:28163610-28163632 GAAGAGAAAATGGAGTAAATCGG + Intronic
929363440 2:41123107-41123129 GGAAAGAAATTTCATTAGAAAGG - Intergenic
930571999 2:53098134-53098156 GAAGAGAAATTACAACAGAAGGG + Intergenic
930825792 2:55695548-55695570 CATGAGAGATTTCAATAGATTGG - Intergenic
931216049 2:60245845-60245867 ATAGAGGAAGTTCAGTAGATTGG - Intergenic
931832455 2:66066725-66066747 GAAGGGATATAGCAGTAGATGGG + Intergenic
931841115 2:66149827-66149849 GAAGAGAAAATTCATTGAATTGG - Intergenic
933697983 2:85234610-85234632 GAACATAAATTCCAGCAGATGGG - Intronic
933933035 2:87174480-87174502 GATGAAAAATTTCTGGAGATTGG - Intergenic
934721720 2:96582455-96582477 AAATAGAAAATTCAGTGGATGGG - Intergenic
935344264 2:102090590-102090612 GAAGTGAAAATTCAGCTGATGGG - Intronic
935369740 2:102332853-102332875 GAACAGAAAATTGAGTAGTTAGG + Intronic
935699694 2:105800956-105800978 GAGGAGAAGTGTCAGAAGATTGG + Intronic
935998422 2:108799897-108799919 AAATAAAAATTTCACTAGATGGG - Intronic
936237484 2:110755824-110755846 GGTGGGAAAATTCAGTAGATGGG - Intronic
936360077 2:111790967-111790989 GATGAAAAATTTCTGGAGATTGG + Intronic
937519322 2:122692304-122692326 GAGGAAAAATATCAATAGATTGG - Intergenic
937582793 2:123508897-123508919 GAAGAAAGTTTTCAGTATATAGG + Intergenic
938134248 2:128740837-128740859 GAAGTGAAAATTTAATAGATAGG + Intergenic
938570828 2:132560522-132560544 GATGAGCCATTTCAGTAGAGCGG - Intronic
939432412 2:142128997-142129019 GAAGTCAAATTTCTGGAGATTGG + Intronic
940191095 2:151040843-151040865 GAAGAGACTTTTCAGAAGACAGG - Intronic
940427926 2:153552158-153552180 AAAGAGAAGTTTCAGTGGAGTGG + Intergenic
940795078 2:158069356-158069378 GAAGAGATATTGCAGGAGAAAGG + Intronic
941254119 2:163206334-163206356 GAAGAATAAGTACAGTAGATGGG + Intergenic
943076483 2:183201570-183201592 TAAGAGAAATTTGAATAGCTAGG + Intergenic
943619297 2:190130192-190130214 GAGAAGGAATTTCAGTAGATGGG - Intronic
943854097 2:192766150-192766172 GAAGGAAACTTTCAGTACATGGG + Intergenic
944263772 2:197702121-197702143 CAAGAGAAACTTCAGCATATAGG + Intronic
944872267 2:203925522-203925544 GTAGAGAAATGTTAATAGATTGG - Intergenic
945408543 2:209481379-209481401 GTAGAGAAAGCTCAGTAGTTGGG - Intronic
946498319 2:220218739-220218761 GAAGGAAAATTTCAGAAGATGGG + Intergenic
1169638891 20:7725930-7725952 TAAGAGCAATTTCAGTGGAGTGG + Intergenic
1170513213 20:17100692-17100714 GAAAAGAAATGTCAGCATATTGG + Intergenic
1170700374 20:18698056-18698078 GAAGAGAAATTCCAAGAAATGGG + Intronic
1170735305 20:19009057-19009079 GAACAGAAATTTTCATAGATGGG + Intergenic
1172323405 20:34015665-34015687 AATGAGAAATTTCTGCAGATAGG + Intronic
1172858328 20:38025801-38025823 AAAGAAAAACTTCAGTGGATGGG + Intronic
1173703494 20:45093642-45093664 GAAGAGAAGATTCAGCAGGTGGG + Exonic
1173835940 20:46125735-46125757 GAGGAGAAATTACAGAAGAGTGG - Intronic
1173879397 20:46400277-46400299 GAAAAGAAACATCAGGAGATAGG + Intronic
1174434738 20:50498110-50498132 GAAGAGAAAGATGAATAGATAGG + Intergenic
1174960981 20:55156531-55156553 AAATAGTAGTTTCAGTAGATTGG - Intergenic
1175393869 20:58645245-58645267 AAAGAGAAATTTCAATCTATTGG + Intergenic
1176054754 20:63138783-63138805 GAAGAGACATTTCACCAGAGAGG + Intergenic
1179198404 21:39188518-39188540 GAAGAAAAAGTTCAGAAGGTTGG - Intronic
949275468 3:2274698-2274720 GAAGAGAAATTTGAGGAGGGAGG + Intronic
949688613 3:6608208-6608230 GAAAAAAAATCTCAGTAGATGGG - Intergenic
949749696 3:7337393-7337415 AAAGACAAATATAAGTAGATGGG + Intronic
950315302 3:11996699-11996721 GAAGATAAAAATCAGGAGATAGG + Intergenic
952675560 3:36026174-36026196 GGAGAAAAATTTCAGAAGCTTGG - Intergenic
953087391 3:39683351-39683373 CAAGAGAAATTTCAGGAAAGTGG + Intergenic
955887145 3:63612785-63612807 AAAGAGAAAGATCAATAGATAGG + Intronic
956441931 3:69289105-69289127 GAAGAGAAAGTTAAGTACAAAGG + Intronic
956511184 3:69995124-69995146 GAAGAGGAAATACAGAAGATAGG + Intergenic
957222621 3:77403299-77403321 GAAGAATAAGTTCAATAGATGGG - Intronic
958682463 3:97349376-97349398 GAAGAGAAACATAAGTATATGGG - Intronic
959274419 3:104259788-104259810 GAAGAGAAATCCCAGTGGTTTGG - Intergenic
960422324 3:117462246-117462268 GAAAATAAATTTAAGTAAATTGG + Intergenic
960511458 3:118554276-118554298 GAAGGGAAAGTTAATTAGATTGG - Intergenic
962791373 3:138814557-138814579 GAAGAGATATTTAAGGAGAGAGG - Intronic
963495445 3:146053832-146053854 TAAAAAAAAATTCAGTAGATGGG + Intergenic
964512498 3:157468144-157468166 GAGCAGGAATTTCACTAGATAGG - Intronic
965046106 3:163579922-163579944 GAAAAGAAATATCAATAAATAGG - Intergenic
965578849 3:170245904-170245926 AAAGAGACATTTCAGAATATGGG - Intronic
965751754 3:171982375-171982397 GAAGTGACATCTCAGTAAATTGG + Intergenic
965972470 3:174577983-174578005 AAAGAAAAATTTCAGTGGATGGG + Intronic
966065396 3:175815632-175815654 GAAAAGAAAATTCATTAGAGGGG + Intergenic
966088370 3:176099254-176099276 GAAGAAAAATTTCAATTGAAGGG + Intergenic
967133004 3:186489778-186489800 TTAGAGAAAATTCAGTAGATTGG + Intergenic
967404413 3:189099797-189099819 GAAGAGAGATTTCAGCAGGATGG - Intronic
967646769 3:191934280-191934302 TAAGAGAAATTTCAGAGAATAGG - Intergenic
970037501 4:11754514-11754536 GAAGAGGAGTTGGAGTAGATGGG + Intergenic
970224538 4:13844032-13844054 GAAGGGAAATTTTTCTAGATGGG - Intergenic
970234834 4:13948043-13948065 GAATGGAAATTTCAGAAGAGGGG + Intergenic
971610207 4:28714296-28714318 GAATACTAATTTCAGTAGATTGG - Intergenic
973042633 4:45491256-45491278 GAAAAGTAATTTCAGTAATTGGG - Intergenic
974512269 4:62858667-62858689 GAAGAAAAAGTTCTGGAGATTGG - Intergenic
975320542 4:73005464-73005486 GAGTAGTAATTTCAGAAGATGGG + Intergenic
975353915 4:73377143-73377165 GAAGTGAAAAGTCAGCAGATTGG - Intergenic
976088708 4:81432801-81432823 GAAGAAAAATATTAGTAGAATGG - Intronic
976616583 4:87084193-87084215 GAAGAAATATTTAAGTAGGTAGG + Intronic
976625636 4:87178853-87178875 GAAGAGTAATTTTAGAAGGTAGG - Intronic
977131276 4:93241744-93241766 TAACTGAAATTTCAGTAGAGGGG + Intronic
977380528 4:96267520-96267542 GAAGATAGATTTTAATAGATGGG - Intergenic
977982540 4:103341786-103341808 GGAGAGAAGTTTCATGAGATTGG + Intergenic
980386859 4:132097394-132097416 GAAAAGATATTTCAGCACATTGG + Intergenic
981713211 4:147729211-147729233 GAAGAGAAATCTCTGTACAGTGG - Intergenic
981921680 4:150091901-150091923 GATGAGAAAGTTCTGGAGATCGG - Intronic
982812781 4:159847068-159847090 GATGAGAGAATTCAGGAGATGGG - Intergenic
983872827 4:172841829-172841851 TAAGAGAAATGGCAGAAGATAGG - Intronic
985002493 4:185499881-185499903 GAAGAGAATTTTCCACAGATGGG + Intergenic
985078275 4:186240436-186240458 GTAGAGTCATTTCACTAGATAGG - Intronic
986033956 5:3920116-3920138 GTAGAGAAATTTCAGTTCTTTGG - Intergenic
986135311 5:4971717-4971739 GTAGAGAAATGACAGAAGATGGG - Intergenic
986952134 5:13101600-13101622 GAAGAGAAAAATCAGTCAATAGG + Intergenic
987175066 5:15299434-15299456 GAAGAAAAATTTCAATATTTTGG - Intergenic
987573037 5:19689296-19689318 TAAGAGAACTCTCAGCAGATTGG + Intronic
988746361 5:34142607-34142629 TAAGAGTAATGACAGTAGATAGG - Intergenic
989398651 5:40985460-40985482 GAAGAAAAATCTCAGTGGACTGG - Intergenic
989608624 5:43270420-43270442 GAAGAGAGATTCCAGTAGGTTGG + Intronic
989853116 5:46240985-46241007 AAAGAGAAGTTTAAGTATATGGG + Intergenic
990874126 5:60465187-60465209 GAAGAGATATTTCTTTAGCTTGG - Intronic
991642322 5:68767505-68767527 GAAATGAAATTTCAGTGGATTGG - Intergenic
992321026 5:75613112-75613134 CAAGAGCAGTTTCAGTAGAGGGG + Intronic
993372013 5:87104251-87104273 GAAGGGAAATTTCTGTAACTAGG + Intergenic
993621369 5:90172052-90172074 TAAGTGAAATTGTAGTAGATTGG - Intergenic
994581615 5:101649373-101649395 GAAGAGAAATTTTGGAAAATGGG + Intergenic
994608774 5:102008613-102008635 GAAGAAAAATTTCAGAAAAGAGG + Intergenic
994675136 5:102811476-102811498 GAAGAGTCATGTCATTAGATTGG + Intronic
994862773 5:105219729-105219751 GGAGGGAAATGTCAGTAGACTGG - Intergenic
996389669 5:122946365-122946387 GAAGTGAAATTTCAATAAAAAGG + Intronic
996422699 5:123279532-123279554 GAAGAGGAATTACGGCAGATAGG - Intergenic
996495285 5:124148560-124148582 GTAGAGAAATATCATCAGATGGG + Intergenic
996567945 5:124901189-124901211 GATGAGTACTTTGAGTAGATAGG + Intergenic
998079843 5:139265793-139265815 GAACAGAAATTCCAGTGGGTTGG + Intronic
999171370 5:149598007-149598029 GATGAGAAATCTCAGAAGCTGGG - Intronic
999503117 5:152166495-152166517 GAAAAGAATGGTCAGTAGATTGG - Intergenic
1000510677 5:162178149-162178171 GTAGAGAAATGTCAGTGGATAGG - Intergenic
1003594620 6:7463244-7463266 GAAGAAAAAATTCGGGAGATGGG + Intergenic
1003689967 6:8344228-8344250 AAGGAGATATTTCAGTAGAATGG + Intergenic
1005310891 6:24557721-24557743 GAAGAGAAATTTTAAAGGATTGG + Intronic
1005544509 6:26850836-26850858 TAAGAGTAATGACAGTAGATAGG - Intergenic
1006891073 6:37429193-37429215 AAACAAAAATTTCACTAGATAGG - Intergenic
1008168509 6:48171099-48171121 GAATAAAAAGTTCAGTAGATGGG + Intergenic
1008711629 6:54234663-54234685 ACAGAGCAATTTCAGTAGAGTGG - Intronic
1009015298 6:57892462-57892484 TAAGAGTAATGACAGTAGATAGG - Intergenic
1009762033 6:68019882-68019904 AAAGATAAATTTCATTTGATTGG - Intergenic
1009766402 6:68081820-68081842 GAAGAGAAATGTGAATAGAAAGG - Intergenic
1010929623 6:81785372-81785394 ATAGAGAAAATTCATTAGATAGG - Intergenic
1012107696 6:95185500-95185522 GAAAAGAAATTTATGCAGATAGG - Intergenic
1012328625 6:97956800-97956822 TAAAAGAAACTTCAGTACATAGG + Intergenic
1012585578 6:100918206-100918228 GAAGAGAAATTTATACAGATGGG + Intergenic
1012742335 6:103033901-103033923 GAAAATAAAATTCACTAGATTGG - Intergenic
1013591713 6:111624177-111624199 GGAGAGAAATTTCTGGAGAGAGG - Intergenic
1014031996 6:116716696-116716718 GAGGCAAAATATCAGTAGATAGG - Intronic
1014502063 6:122203760-122203782 GAAGAAAAACTCCAGTAGAGTGG - Intergenic
1014593820 6:123307574-123307596 GGAGAGCATTTTCAGTAGAGTGG - Intronic
1016529875 6:145045856-145045878 GAAGAGAAATCCAAGAAGATTGG + Intergenic
1017480705 6:154851534-154851556 GGAAAGAAATTTCAATGGATTGG - Intronic
1018461262 6:164001115-164001137 GAAGAGAAATCACAGAAGTTGGG - Intergenic
1019721041 7:2571350-2571372 AAGGAGAAATGTCAGTATATAGG + Intronic
1020377059 7:7500174-7500196 AAAGAATAATTTCAGTAGAAGGG - Intronic
1021439673 7:20663637-20663659 GATGAGAAAGTTCTGGAGATGGG + Intronic
1023225784 7:37967394-37967416 AAATAGTAATTTCAGTAGAGAGG - Intronic
1024017237 7:45328190-45328212 GAACAGAAATTTGAGTAGATTGG + Intergenic
1024042218 7:45564551-45564573 GAAAAGAAATCTCATTAGATAGG - Intergenic
1026124222 7:67565332-67565354 GGAGAGGAATTTGAGGAGATGGG + Intergenic
1028364412 7:90010882-90010904 GAAATGAAATTTCAGTAGGAAGG - Intergenic
1030303383 7:107996648-107996670 GAAGAGATTTTCCAGTAGAGGGG - Intronic
1031062735 7:117070483-117070505 GATGAGAAAGTTCTGGAGATTGG + Intronic
1031109293 7:117586695-117586717 GAAGAGAAGTTTTAGTAGAGGGG + Intronic
1031784788 7:126015961-126015983 TAAAAGGAATTTCAGTAAATAGG + Intergenic
1032604527 7:133335296-133335318 GATGAGATATTTCTGGAGATTGG - Intronic
1033860959 7:145626710-145626732 GAAGAGCATTTTAAGTAAATTGG + Intergenic
1033915470 7:146319449-146319471 CAAGAGAGATTTTAGTAGACCGG + Intronic
1035114416 7:156511100-156511122 AAATAAAAATTTCACTAGATGGG + Intergenic
1037382482 8:18301654-18301676 GAAGAGAAATGTTAGTACATGGG - Intergenic
1037639218 8:20727514-20727536 GAAGAGAAATTTCAACGGATTGG + Intergenic
1038231320 8:25703346-25703368 GAAAAGTAATGTCAGTGGATGGG + Intergenic
1038864158 8:31421178-31421200 CAAGAGAAATATCAGTTAATTGG - Intergenic
1041004997 8:53488938-53488960 AAAGAGAAGTTTCAGTGGAGTGG - Intergenic
1041224615 8:55686030-55686052 GAAAAGAAATTTCAGCATGTTGG + Intergenic
1041290539 8:56304154-56304176 GAAAAGAAATTTCTGTACACAGG + Intronic
1041516225 8:58701502-58701524 GAAGAGAAATTTCTGATGAAGGG + Intergenic
1042015950 8:64311607-64311629 GAAGTAAAAATTCAGTAGATTGG + Intergenic
1043584633 8:81754062-81754084 GCAGACAAATTTCTGTAGAGTGG + Intronic
1043964153 8:86453137-86453159 GATGAAAAATTTCTGGAGATTGG - Intronic
1044233391 8:89804543-89804565 GAAGAGCAATTTCAATGGAGTGG - Intergenic
1046071145 8:109255365-109255387 AAAGAGATATTTAAGTATATAGG - Intronic
1046258595 8:111735246-111735268 AAAGAGGAATTTCAGTAGTGGGG + Intergenic
1046420214 8:113972026-113972048 GAAGAAAAATTTCAGAACTTAGG + Intergenic
1046480121 8:114805802-114805824 GATGAAAAATCTCAGAAGATGGG - Intergenic
1047052762 8:121131385-121131407 GAAGAGAAATTTTGGTACACAGG + Intergenic
1047556324 8:125934788-125934810 TAAGAGAAATTACAGGAGGTGGG - Intergenic
1049652018 8:143774394-143774416 GAAGAGAAATTTCACCAAAGAGG + Intergenic
1050883546 9:10735855-10735877 GAAAAGAAACTTCTGTAGAAGGG + Intergenic
1051930657 9:22381256-22381278 CAAGGGAAATTTCAATAGGTTGG + Intergenic
1052091066 9:24328456-24328478 TAAGAGACATATCAGAAGATAGG + Intergenic
1052829306 9:33202169-33202191 CAAGAGCAGTTTCAGTAGAAGGG + Intergenic
1053555627 9:39134183-39134205 AAAGAGATATTTCAGTAGCATGG - Intronic
1053819746 9:41954443-41954465 AAAGAGATATTTCAGTAGCATGG - Intronic
1054110014 9:61098100-61098122 AAAGAGATATTTCAGTAGCATGG - Intergenic
1054610843 9:67233025-67233047 AAAGAGATATTTCAGTAGCATGG + Intergenic
1055749553 9:79489569-79489591 GAAGAGAAATTCCAGAGGAGGGG + Intergenic
1055995059 9:82148336-82148358 AAAAATAAATTTCAGTGGATTGG - Intergenic
1056484346 9:87040487-87040509 GAAGAGATATTTTAGTAAGTTGG - Intergenic
1056946889 9:91005242-91005264 GAAGAGAGATGTCAGTGGAATGG - Intergenic
1057718415 9:97513861-97513883 GACTAGAAATTTCAATGGATTGG + Intronic
1058204706 9:102089233-102089255 GAAGGGTAATTTCACTAGAAGGG - Intergenic
1058348650 9:103995108-103995130 GGACAGAAATTGCAGAAGATTGG + Intergenic
1185616355 X:1424343-1424365 GAACAGATATATCAGTGGATCGG - Intronic
1186238942 X:7546087-7546109 GCAGAGAAATTTTAGTAGACAGG + Intergenic
1189503355 X:41585126-41585148 GAAGAGAAAGTTCAAGAGAAGGG + Intronic
1189730919 X:44020033-44020055 GAAGAGAAAGTTCTGGAGATTGG - Intergenic
1189841007 X:45077867-45077889 GATGAGAAAGTTCTGGAGATTGG - Intronic
1190078878 X:47339404-47339426 GAAGAGATATTTCACTAAAGAGG - Intergenic
1190102860 X:47535876-47535898 GAAGAGACATTTCACTGAATGGG + Intergenic
1190772992 X:53530600-53530622 AAAAAAAAATTTCAGTAGAGAGG + Intergenic
1190850193 X:54232905-54232927 GCAAAGGAATCTCAGTAGATTGG + Exonic
1192616830 X:72633631-72633653 GAAGAGAAAGTACACTGGATTGG - Intronic
1192800468 X:74460472-74460494 TAAGAGAAATGACAGCAGATAGG - Intronic
1193005299 X:76611245-76611267 GTAGAGAAATTTCACTTGTTTGG - Intergenic
1193415232 X:81214244-81214266 GAAAAGCGGTTTCAGTAGATTGG + Intronic
1193742026 X:85228578-85228600 CAAGAGCAATTTCAGTGGAGTGG - Intergenic
1195005393 X:100680622-100680644 GAAGAGCATTTTCAGAAGAGGGG - Intronic
1195759560 X:108231416-108231438 GAAGAGAAATATCAGTAAACAGG - Intronic
1195760957 X:108245961-108245983 GAATAGAGATATCAGTAGCTTGG - Intronic
1196422185 X:115534299-115534321 TGAGAGAAATTTCAGTAAAATGG + Intergenic
1197772635 X:130099056-130099078 GAATACAATTTTCAGTAGTTTGG + Intronic
1198176708 X:134163689-134163711 GAGGTGACATTTGAGTAGATGGG - Intergenic
1199373529 X:147080587-147080609 GTAGAGAAACTGCAGGAGATAGG - Intergenic
1199443144 X:147891419-147891441 TAAGAAAAATGTTAGTAGATAGG - Intergenic
1199659981 X:150039248-150039270 GAAGAGACATTTCACCAAATAGG + Intergenic
1199966523 X:152824965-152824987 GAAGGGAAATTGCAGAGGATAGG - Intergenic
1200180800 X:154149570-154149592 AAAGAGAAATTACCATAGATTGG + Intronic
1200186443 X:154186684-154186706 AAAGAGAAATTACCATAGATTGG + Intergenic
1200192095 X:154223822-154223844 AAAGAGAAATTACCATAGATTGG + Intronic
1200197850 X:154261626-154261648 AAAGAGAAATTACCATAGATTGG + Intronic
1200338277 X:155375205-155375227 CAAGAGCAATTTCAGTGGAGGGG - Intergenic
1200344412 X:155434686-155434708 GATGAGAAATTTGGGTAGAATGG - Intergenic
1200348192 X:155465487-155465509 CAAGAGCAATTTCAGTGGAGGGG + Intergenic
1201103176 Y:10693958-10693980 GAATAGAAAGTTCAGTTGAGTGG - Intergenic