ID: 1149286493

View in Genome Browser
Species Human (GRCh38)
Location 17:55171216-55171238
Sequence GAGGCACACCTGATGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149286493_1149286495 18 Left 1149286493 17:55171216-55171238 CCACAAAACATCAGGTGTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 117
Right 1149286495 17:55171257-55171279 AGCACAAAATCCTAGAATTGAGG 0: 1
1: 0
2: 1
3: 21
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149286493 Original CRISPR GAGGCACACCTGATGTTTTG TGG (reversed) Intergenic
901123033 1:6910484-6910506 GAGGCTCAGCTCATTTTTTGAGG + Intronic
902533775 1:17107188-17107210 AAGGCACAGCTGCTATTTTGGGG + Intronic
912805632 1:112754916-112754938 CAGGCATAGCTGGTGTTTTGTGG + Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918839922 1:189521387-189521409 GAGCCATACATGCTGTTTTGAGG - Intergenic
919524050 1:198625270-198625292 GAGAGACACATGGTGTTTTGGGG - Intergenic
919644669 1:200082806-200082828 GATGCACAGCAGGTGTTTTGAGG - Intronic
920393723 1:205628676-205628698 GGGGAACACCTGTTATTTTGGGG - Intronic
922080344 1:222289694-222289716 CAGACTAACCTGATGTTTTGTGG - Intergenic
1063201939 10:3792591-3792613 GAGGCACAACTGATGTTTAGTGG + Intergenic
1067288481 10:44924483-44924505 GAGGCCCACCTGGTCTTCTGTGG - Intronic
1070357552 10:75655504-75655526 GAGGCCCAACTGATCATTTGTGG + Intronic
1070400547 10:76049791-76049813 AAGGCAAACCTCGTGTTTTGTGG - Intronic
1070526339 10:77298937-77298959 GAGGCCCATCTGATGCTCTGGGG - Intronic
1072399852 10:95086809-95086831 GAAGTATACCTGGTGTTTTGTGG + Intergenic
1073005671 10:100322134-100322156 GAGGCTCACCTGAGAGTTTGAGG + Intronic
1073777733 10:106805323-106805345 GAGGTACCTCTGATGTTGTGAGG + Intronic
1074872135 10:117585594-117585616 GAAGCTCATCTGCTGTTTTGTGG + Intergenic
1075611196 10:123856080-123856102 AAGAAACAGCTGATGTTTTGAGG - Intronic
1077142478 11:1030647-1030669 GTGGCACAACTGCTGTTCTGTGG + Exonic
1078233025 11:9460221-9460243 GAGACACCACTGATGCTTTGTGG - Intergenic
1078635136 11:13042681-13042703 GAGGCACACGTGATGTGTATGGG + Intergenic
1080480818 11:32648006-32648028 GAGGAACAGCTGAGGTTTGGGGG - Intronic
1086640377 11:89147446-89147468 GTGGCACTCCTGAAGTTTTATGG + Intergenic
1087412721 11:97812072-97812094 GAAGCACACCGAAAGTTTTGGGG + Intergenic
1090191431 11:124772211-124772233 GAGGGACACCTGAAGTATTTTGG - Intronic
1091570860 12:1684203-1684225 TAGCCACACCTGAGGTATTGCGG - Intergenic
1095735048 12:45547367-45547389 GAGGAACACCTGTTGCTTTGTGG + Intergenic
1103076484 12:117986829-117986851 GAGTCACAGCTTATGCTTTGTGG + Intergenic
1108443506 13:50481034-50481056 GAGGAACAACTGATTCTTTGAGG + Intronic
1108585805 13:51868907-51868929 GAGGCACAGCTCAGGCTTTGCGG - Intergenic
1110794406 13:79620150-79620172 TAGGATCAACTGATGTTTTGGGG - Intergenic
1112584677 13:100707900-100707922 GAGAGACACCTGAGGTTTTGAGG - Intergenic
1115728082 14:36238909-36238931 GAGGCAGAACTCATGATTTGTGG + Intergenic
1120002584 14:79319520-79319542 GAAGCAGACTTGATGTTTTAGGG + Intronic
1121076005 14:91068819-91068841 CAGGCATACCTCATGGTTTGTGG - Intronic
1121258192 14:92546833-92546855 CAGGGACACCTGTTGCTTTGGGG - Intronic
1126402571 15:48288136-48288158 AAGGCACAATTGATGTTTGGTGG + Exonic
1126525094 15:49644994-49645016 GTGGGACACATGATGTTTTATGG + Exonic
1127043004 15:54997790-54997812 GAGGGGCACCTATTGTTTTGGGG - Intergenic
1127466626 15:59250369-59250391 GAGGCTCAGGTGATGTTTTCTGG + Intronic
1135482628 16:22833536-22833558 GAGGCACACCGGACCTTTTTGGG + Intronic
1137903939 16:52300150-52300172 CAGGGACACCTGATATTTCGTGG - Intergenic
1138305635 16:55972004-55972026 GAGGAAGACATGATGGTTTGTGG + Intergenic
1139280067 16:65763135-65763157 GAGTCAAACCTGTTGGTTTGGGG + Intergenic
1140327940 16:74023910-74023932 GAGGCAGAGCCCATGTTTTGGGG + Intergenic
1140733710 16:77879234-77879256 CAGGCACATCTGATGTACTGTGG + Intronic
1141769729 16:86082544-86082566 GATGGACAGCTGATGTTTGGAGG + Intergenic
1143778835 17:9218732-9218754 GAGCCTCATCTGATGCTTTGAGG - Intronic
1144483355 17:15645403-15645425 CAGGCAAACCTGAGGTTTTTGGG - Intronic
1144915333 17:18719623-18719645 CAGGCAAACCTGAGGTTTTTGGG + Intronic
1149286493 17:55171216-55171238 GAGGCACACCTGATGTTTTGTGG - Intergenic
1149400238 17:56288745-56288767 GAGGCACACCGGACCTTTTTGGG - Intronic
1149401217 17:56297740-56297762 GAAGCACACCTAAGGTTGTGAGG - Intronic
1151898986 17:76999223-76999245 GAAGCTCACCTGAGGCTTTGGGG - Intergenic
1153437545 18:5083880-5083902 GAGGCCCAGCTTAAGTTTTGTGG - Intergenic
1158110150 18:53931767-53931789 AAGGACCACCTGATGTTATGAGG - Intergenic
1159191188 18:65045014-65045036 CAGGCACACCTTGTTTTTTGGGG + Intergenic
1160826350 19:1082253-1082275 GAGGCACACCTGACGCTGTGCGG + Intronic
925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG + Intergenic
926296424 2:11572340-11572362 GAGGCATCCCTGAGGTTTTGTGG + Intronic
929192580 2:39153259-39153281 GAGGCACACATCAAGTTCTGTGG - Intergenic
930624663 2:53683139-53683161 GAGGCATACCCGGTTTTTTGAGG + Intronic
931444261 2:62313760-62313782 GGGGCACACCTTCTGTTTGGGGG + Intergenic
932944905 2:76217047-76217069 GAGGCACACCTGGAATTCTGAGG - Intergenic
933832246 2:86220259-86220281 GAGGAAGCACTGATGTTTTGGGG + Intronic
933989631 2:87624976-87624998 GAGCCACACCCGATGCATTGTGG - Intergenic
934149878 2:89135997-89136019 GAGGCTGACCTGATGCTCTGAGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935401001 2:102660167-102660189 GAGGCACAACTGTGGTTTTATGG + Intronic
936304213 2:111325850-111325872 GAGCCACACCCGATGCATTGTGG + Intergenic
940068162 2:149653165-149653187 GATGCAGACCTGATGATGTGTGG - Intergenic
942530412 2:176903874-176903896 TAGGAACACCTAATATTTTGTGG + Intergenic
944083779 2:195820529-195820551 GAGTCACCTCTGATGATTTGTGG - Intronic
946805717 2:223469467-223469489 GAGGGACACGTGACCTTTTGAGG - Intergenic
1177929591 21:27264527-27264549 GAGGCACACGTTATCTTCTGTGG - Intergenic
1178475371 21:32933062-32933084 GGGGCAGACCAGATGTTTTAAGG + Intergenic
1179261246 21:39759888-39759910 GAGGCATACGTGCTGTCTTGAGG + Intronic
1179542116 21:42089897-42089919 GAGCCACCCCTGACGTTCTGAGG - Intronic
1181059794 22:20276877-20276899 GAGGCACACTTGCTGTTCTTTGG - Intronic
1184437022 22:44485286-44485308 GACTCACACCTGGTGTTTTTTGG + Intergenic
1184803628 22:46777405-46777427 GGGGCACAGCTGATTTTTTGGGG + Intronic
949257196 3:2062543-2062565 GAGGCAAATCCCATGTTTTGTGG - Intergenic
950834110 3:15903013-15903035 CAGGCACACCAAATGTATTGAGG + Intergenic
951965434 3:28379007-28379029 AAGGCACACCTGATATTTTCAGG - Intronic
952120789 3:30241722-30241744 GAGGCATACATAATGTCTTGTGG - Intergenic
953493360 3:43367465-43367487 GAGAAACATCTGATGATTTGGGG - Intronic
953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG + Intergenic
953964649 3:47294546-47294568 GGAGCACACTTGGTGTTTTGGGG + Intronic
954646818 3:52136646-52136668 AAGGGACAGCTGATGGTTTGGGG - Intronic
954909171 3:54088358-54088380 GTTGCACACCTAATGTTGTGGGG + Intergenic
956379371 3:68649501-68649523 GAGGCACATCTTTTTTTTTGGGG - Intergenic
957248614 3:77744641-77744663 GAGACAGACATGAAGTTTTGGGG + Intergenic
962008091 3:131368451-131368473 AAGTCACTCCTGATGTTGTGTGG + Intergenic
963064854 3:141255637-141255659 GAGTCTCACCAGATGTCTTGAGG + Intronic
978589392 4:110308599-110308621 GAGGTACATGTGATATTTTGTGG - Intergenic
979217448 4:118182461-118182483 GAGGCATCCCAGATTTTTTGTGG - Intronic
980076856 4:128303181-128303203 GAGCCACACCAGATCTTTTCAGG - Intergenic
982283269 4:153707850-153707872 GAGGATCACCTGAGGTGTTGTGG + Intergenic
983318847 4:166168925-166168947 GAGGTAAACCAGAAGTTTTGAGG + Intergenic
996782044 5:127197880-127197902 GAGGGACACCTGCCTTTTTGAGG - Intergenic
997243368 5:132324951-132324973 GAGGCACTGCTGGTGGTTTGGGG + Intronic
1000162000 5:158606892-158606914 GAGACACACCTGCTGTTTAAAGG + Intergenic
1005437357 6:25829105-25829127 AAGGCCCAACTTATGTTTTGAGG - Intronic
1010009762 6:71036488-71036510 GAGGTATACCAGAAGTTTTGTGG - Intergenic
1013005013 6:106064466-106064488 GACTCAAACCTGATGTTTTGAGG + Intergenic
1018297946 6:162369420-162369442 GAGTCACACCTGATGTTCAAGGG - Intronic
1019353373 7:565702-565724 GAGGCACACGGGACGTTTTCTGG + Intronic
1021956502 7:25830363-25830385 GAGGCACACATGAGGCTTTAAGG - Intergenic
1023476703 7:40587161-40587183 GAGACACAACAGATTTTTTGGGG + Intronic
1035240668 7:157527166-157527188 TAGGCACACGTGATGGTTTAGGG - Intergenic
1035331392 7:158099160-158099182 GAGGCACCCGGGATGTGTTGGGG - Intronic
1038485087 8:27929360-27929382 TAGGGACACCTGATGTATTGGGG - Intronic
1043861237 8:85319661-85319683 GATGCTCATCTGATGTTCTGGGG + Intergenic
1044459208 8:92425597-92425619 GAGGAAGAACTGATCTTTTGAGG + Intergenic
1045187448 8:99853526-99853548 GAAGCTCAGCTGATGCTTTGTGG - Exonic
1045627361 8:104070573-104070595 TAGACACACCTGACCTTTTGTGG + Intronic
1047926104 8:129684077-129684099 CAGGCACAAATGATGTTTTCAGG - Intergenic
1049382782 8:142325679-142325701 GAGGGACACCTGGGGTTCTGGGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1062107111 9:134761763-134761785 GAGGCACACGTGATCTTCTAAGG + Intronic
1062478001 9:136738884-136738906 GAGTCAGACCTGCTGTTGTGGGG + Intronic
1186364303 X:8875177-8875199 GAGGCAAACCTCATTTTTGGAGG + Intergenic
1188531779 X:31149252-31149274 TATGGACACTTGATGTTTTGCGG - Intronic
1189019121 X:37316403-37316425 CAGGCCCACCTGATGGCTTGTGG + Intergenic
1189881489 X:45498020-45498042 AAGGCTCACCTGATCTTATGAGG + Intergenic
1191587472 X:62844385-62844407 GTGGCACACTTGATGTTCTAGGG + Intergenic
1195413763 X:104597801-104597823 GAGGCACAGCAGGTTTTTTGGGG + Intronic
1197313201 X:124931461-124931483 CAGGCACACCTGTTCTTTTCAGG + Intronic