ID: 1149287868

View in Genome Browser
Species Human (GRCh38)
Location 17:55185937-55185959
Sequence TGGATCCTGGGTCCCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149287868_1149287874 10 Left 1149287868 17:55185937-55185959 CCATGGCTGGGACCCAGGATCCA No data
Right 1149287874 17:55185970-55185992 CACCAGAGCATGAAGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149287868 Original CRISPR TGGATCCTGGGTCCCAGCCA TGG (reversed) Intergenic
No off target data available for this crispr