ID: 1149287871

View in Genome Browser
Species Human (GRCh38)
Location 17:55185949-55185971
Sequence TGCCTCCACACATGGATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149287871_1149287877 19 Left 1149287871 17:55185949-55185971 CCCAGGATCCATGTGTGGAGGCA No data
Right 1149287877 17:55185991-55186013 GGACTTTATCCTGAAGATGATGG No data
1149287871_1149287874 -2 Left 1149287871 17:55185949-55185971 CCCAGGATCCATGTGTGGAGGCA No data
Right 1149287874 17:55185970-55185992 CACCAGAGCATGAAGCAGCCTGG No data
1149287871_1149287879 30 Left 1149287871 17:55185949-55185971 CCCAGGATCCATGTGTGGAGGCA No data
Right 1149287879 17:55186002-55186024 TGAAGATGATGGTGCATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149287871 Original CRISPR TGCCTCCACACATGGATCCT GGG (reversed) Intergenic