ID: 1149287874

View in Genome Browser
Species Human (GRCh38)
Location 17:55185970-55185992
Sequence CACCAGAGCATGAAGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149287868_1149287874 10 Left 1149287868 17:55185937-55185959 CCATGGCTGGGACCCAGGATCCA No data
Right 1149287874 17:55185970-55185992 CACCAGAGCATGAAGCAGCCTGG No data
1149287873_1149287874 -10 Left 1149287873 17:55185957-55185979 CCATGTGTGGAGGCACCAGAGCA No data
Right 1149287874 17:55185970-55185992 CACCAGAGCATGAAGCAGCCTGG No data
1149287871_1149287874 -2 Left 1149287871 17:55185949-55185971 CCCAGGATCCATGTGTGGAGGCA No data
Right 1149287874 17:55185970-55185992 CACCAGAGCATGAAGCAGCCTGG No data
1149287872_1149287874 -3 Left 1149287872 17:55185950-55185972 CCAGGATCCATGTGTGGAGGCAC No data
Right 1149287874 17:55185970-55185992 CACCAGAGCATGAAGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149287874 Original CRISPR CACCAGAGCATGAAGCAGCC TGG Intergenic
No off target data available for this crispr