ID: 1149290382

View in Genome Browser
Species Human (GRCh38)
Location 17:55212808-55212830
Sequence TATCAGGATTAAAACTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149290378_1149290382 -2 Left 1149290378 17:55212787-55212809 CCTGTTATCCTCTTGAGCATCTA No data
Right 1149290382 17:55212808-55212830 TATCAGGATTAAAACTGGAGAGG No data
1149290380_1149290382 -10 Left 1149290380 17:55212795-55212817 CCTCTTGAGCATCTATCAGGATT No data
Right 1149290382 17:55212808-55212830 TATCAGGATTAAAACTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149290382 Original CRISPR TATCAGGATTAAAACTGGAG AGG Intergenic
No off target data available for this crispr