ID: 1149294357

View in Genome Browser
Species Human (GRCh38)
Location 17:55248344-55248366
Sequence CTGTCCAGAGATAGGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149294357_1149294359 12 Left 1149294357 17:55248344-55248366 CCAGGCTGCCTATCTCTGGACAG No data
Right 1149294359 17:55248379-55248401 GAAACAAACTTCTAACCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149294357 Original CRISPR CTGTCCAGAGATAGGCAGCC TGG (reversed) Intergenic
No off target data available for this crispr