ID: 1149296273

View in Genome Browser
Species Human (GRCh38)
Location 17:55265027-55265049
Sequence CGCTGGGGAGCAGCGGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 325}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149296266_1149296273 0 Left 1149296266 17:55265004-55265026 CCCGGCGCTGCGGGGCCGCGGAG 0: 1
1: 0
2: 2
3: 29
4: 289
Right 1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 30
4: 325
1149296267_1149296273 -1 Left 1149296267 17:55265005-55265027 CCGGCGCTGCGGGGCCGCGGAGC 0: 1
1: 1
2: 4
3: 22
4: 225
Right 1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 30
4: 325
1149296261_1149296273 14 Left 1149296261 17:55264990-55265012 CCGGATGCGCTGAGCCCGGCGCT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 30
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149296273 Original CRISPR CGCTGGGGAGCAGCGGCCGC CGG Exonic
900097207 1:944747-944769 CCCTGGGGAGCTGCAGCAGCTGG - Exonic
900165416 1:1242512-1242534 GGCTGGCGAGGAGCTGCCGCCGG - Exonic
900254830 1:1692691-1692713 CACTGAGGAGCGGCGCCCGCGGG - Intronic
900263581 1:1745966-1745988 CACTGAGGAGCGGCGCCCGCGGG - Exonic
900514190 1:3073590-3073612 CGCGGTGCAGCGGCGGCCGCGGG + Intronic
900523184 1:3115998-3116020 CCCTGGGGAGCTGCAGACGCTGG - Intronic
900543263 1:3214843-3214865 CGTTGGGGAGCTGTGGCCCCAGG + Intronic
900694210 1:4000072-4000094 CTCTGGGGAGCAGCGTGTGCGGG + Intergenic
900743619 1:4345350-4345372 CGCTGAGCAGCATCGGCCGGCGG + Intergenic
901005470 1:6169768-6169790 GGCTGGGGCGCTGGGGCCGCAGG - Intronic
901007942 1:6180607-6180629 CGCAGGCGAGCGGCGGCGGCTGG - Intergenic
901059642 1:6466089-6466111 GGCTATGGAGCAGCGGCCGCGGG - Exonic
901240084 1:7687785-7687807 CGCTGGGGAGCAGGGGCTCCAGG + Intronic
901652121 1:10749025-10749047 AGCTGGGACGCAGCAGCCGCAGG - Intronic
901790391 1:11650757-11650779 TGCTGAGGAGGAGCGGCCGGAGG - Exonic
902067519 1:13700393-13700415 CGCTGGGGACCCGGCGCCGCAGG + Intronic
902342909 1:15796082-15796104 CTCTGGGGAACAGAGGCCACCGG - Intergenic
902639089 1:17755280-17755302 CGCTGGGGAGCCCCAGCAGCGGG + Intergenic
903115572 1:21176435-21176457 CGCCGGGGTGCAGGGGCCGGGGG + Intronic
903177291 1:21588772-21588794 GGCTGGGGAGCAGAGGAGGCTGG + Intergenic
903907536 1:26696951-26696973 CGCTGCAGAGCGGCGGCGGCGGG + Exonic
906615831 1:47232238-47232260 GGCGGGGGAGCGGGGGCCGCGGG - Intergenic
908555697 1:65254689-65254711 GGCAGGGGCGCAGCGGCGGCGGG + Intronic
910200113 1:84690466-84690488 CGCAGCGGAGGAGGGGCCGCGGG - Exonic
910968609 1:92832077-92832099 CTCTGTCGAGCAGCGGACGCCGG + Exonic
911440572 1:97921046-97921068 CGCGGGGGCGGAGCGGGCGCGGG + Intronic
912456692 1:109802876-109802898 GGCTGGAGAGCAGCAGCAGCAGG - Intergenic
913670999 1:121097442-121097464 CGGTGGGCAGCAACGGCGGCAGG + Intergenic
914022762 1:143884863-143884885 CGGTGGGCAGCAACGGCGGCAGG + Intergenic
914196113 1:145448869-145448891 CCCTGGGGAGCAGCTCCAGCAGG - Intergenic
914661249 1:149792807-149792829 CGGTGGGCAGCAACGGCGGCAGG + Intronic
915563553 1:156701383-156701405 GGCTGGGGAGAAGCTGCCCCTGG - Intronic
919772483 1:201171305-201171327 CGCGGGGGTGCACTGGCCGCTGG + Intronic
920824422 1:209412120-209412142 TGCTGGGAAGCAGCTGCCCCAGG - Intergenic
921325318 1:213982746-213982768 GGCGGGGGAGGAGAGGCCGCGGG + Intergenic
922416486 1:225427624-225427646 GGCTGTGGAGCGGCGGCGGCAGG - Intronic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
923006522 1:230054266-230054288 GGCTGGGAAGCAGCAGCAGCTGG - Intergenic
924289583 1:242524296-242524318 CGCCGGCGAGCAGCGGACTCGGG + Exonic
924460162 1:244252117-244252139 TGCTGGGGAGCAGCTTCCCCCGG - Intergenic
924804005 1:247348147-247348169 GGCTGGGCCGCAGCGGACGCCGG + Intergenic
1062857143 10:785000-785022 CGCTGGGAAGCAGCTGCCGGTGG - Intergenic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1066126326 10:32346579-32346601 CGCTGGGCCGCGGCGGCCGGGGG + Intronic
1067572976 10:47384829-47384851 GTCTGGGGAGCAGAGGCGGCGGG - Intergenic
1069553839 10:69383716-69383738 AGCTGGGGTGCAGGGGCCCCTGG + Intronic
1069887167 10:71631133-71631155 TGCTGGGGAGCTGAGGCAGCAGG + Intronic
1069942105 10:71963575-71963597 GGCTGGGCAGCACCGGCTGCGGG - Intergenic
1070398904 10:76035816-76035838 GGCGGGGGAGAAGGGGCCGCTGG - Intronic
1071783926 10:88878695-88878717 CGCTGGGGAGCAGGGGACGATGG + Intergenic
1072021815 10:91410223-91410245 CTGTGGGGAGCCGCGTCCGCGGG + Intergenic
1072619104 10:97068065-97068087 TGCTGGGGTGCAGCAGCAGCTGG - Intronic
1072680034 10:97499405-97499427 CGCTGGGGAGCGGCCCCCTCTGG - Intronic
1074586009 10:114768241-114768263 GGCGGGGACGCAGCGGCCGCAGG + Intergenic
1076056931 10:127383609-127383631 GGCTGGGGAGCACCTCCCGCTGG - Intronic
1076364746 10:129914620-129914642 CCCTGGGCAGCAGGGGCCACGGG + Intronic
1076657989 10:132036979-132037001 CGCTGGCGTGACGCGGCCGCTGG + Intergenic
1076881943 10:133243867-133243889 GGCTGGGGAGACGCAGCCGCAGG + Intergenic
1076908884 10:133377753-133377775 CGCTGGGGAGCTGGGGCAGGTGG + Intergenic
1077104751 11:837330-837352 CGCTGTGGACCAGCTGCAGCAGG + Exonic
1077305570 11:1867317-1867339 GGGTGGGGTGCAGCGGCCTCTGG - Intronic
1077403312 11:2369504-2369526 CCCTGGGGAGCAGGGCACGCAGG - Intergenic
1077430866 11:2515453-2515475 TGCTGGGCAGCAGGGGCCTCGGG - Intronic
1081774006 11:45665523-45665545 CGGAGGAGAGCAGCAGCCGCAGG + Exonic
1083369331 11:62165918-62165940 CGCTCGGGACCAGGGGCTGCTGG + Intergenic
1083766259 11:64843001-64843023 AGCTGGGGAGGAGCAGCCCCGGG + Intronic
1083823152 11:65183603-65183625 CCCTGGGGAGGAGGGGCAGCAGG + Intronic
1084014243 11:66369287-66369309 GGCTGGGGGGCAGGGGGCGCAGG + Intronic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084411568 11:69009065-69009087 CGCTGTGGAGTGGCGGCCGCAGG - Intronic
1084438463 11:69157432-69157454 CGCTGGCGAGCAGGGGGCGCGGG + Intergenic
1084563912 11:69919052-69919074 CTTTGGGGAGCAGCCCCCGCGGG - Intergenic
1084651561 11:70492350-70492372 CGCCGGGAAGCACCGGCTGCTGG + Exonic
1089993490 11:122883075-122883097 AGCTGGGGAGGAGCCGGCGCGGG + Intronic
1092743170 12:11649562-11649584 CGCGGGGGAGGGGCGGCCGCGGG - Intergenic
1092926676 12:13278379-13278401 TGCAGGGGAGCAGGGGCCGCTGG + Intergenic
1096498258 12:52051020-52051042 CGCTGTAGAGACGCGGCCGCGGG - Intronic
1098166532 12:67704282-67704304 CTCTGGGGAGAAGGGGCAGCTGG - Intergenic
1100963093 12:99984813-99984835 CGGTGGGGGGCAGCCGCAGCGGG + Intergenic
1101606032 12:106248123-106248145 CGGCGGGGAGGAGGGGCCGCCGG - Intronic
1102536792 12:113587843-113587865 CGCTGGGGCTCAGCGGGGGCTGG - Intergenic
1102646650 12:114408143-114408165 GGCTGGGGGGCAGCGGCGGGAGG + Exonic
1103261771 12:119594486-119594508 CGCTGGAGAGCAGGAGCCCCCGG - Intronic
1103749800 12:123150914-123150936 CGCTCGGGAGCAATGCCCGCCGG - Intergenic
1103928651 12:124437547-124437569 TGCCGGGCAGCAGGGGCCGCAGG - Intronic
1104021212 12:124993722-124993744 CGCTGGGCCGCAGCGGGCTCCGG - Exonic
1105512443 13:21061641-21061663 CGCGGAGGAGCAGGGGCCGCAGG - Intergenic
1112208255 13:97347081-97347103 CGCCGGGGTGCAGGGGCGGCGGG - Intronic
1114865999 14:26597152-26597174 GGCAGGGGCGCAGGGGCCGCCGG + Intronic
1117119720 14:52553655-52553677 CGCTGAGGACCAGCGGGGGCGGG + Intronic
1118586741 14:67360354-67360376 CGCTGAGGAGGATCGGCGGCCGG + Exonic
1118835593 14:69475691-69475713 CGCTGGGGAGTAGGGTCCCCCGG - Intergenic
1122266974 14:100551151-100551173 GGCAGGGGAGCAGGGGCCCCGGG - Intronic
1123033071 14:105460263-105460285 CGCCAGGGACCAGCGGCCACGGG - Intronic
1126852487 15:52805719-52805741 CGCTGGCGAGAAGGCGCCGCTGG + Intergenic
1127317088 15:57807496-57807518 CTCTGTGGAGCAGGGACCGCTGG + Intergenic
1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG + Intronic
1130650767 15:85760887-85760909 CTCTGGGGAGCAGCAGCCTTGGG - Exonic
1131517711 15:93089845-93089867 CGCGGGGGAGCCGCGGCCGTGGG - Intergenic
1132085006 15:98901266-98901288 TACTGGGGAGCAGCAGCAGCAGG - Intronic
1132469766 16:95906-95928 CCCTGGGGAGCACCTGCCTCAGG - Intronic
1132849824 16:2019973-2019995 CGCCGGAGGGCAGCGGCAGCAGG - Exonic
1132883670 16:2173076-2173098 ACCTGGGGTGCAGCGGCCACAGG + Intronic
1133325125 16:4937357-4937379 CACTGGGGCGCAAAGGCCGCCGG + Intronic
1133784237 16:8963011-8963033 CGCGGGCGAGGGGCGGCCGCCGG - Intronic
1133817985 16:9212744-9212766 AGCTGGGGAGCAGCAGACTCTGG + Intergenic
1134019662 16:10912773-10912795 CTCTGGGGAACAGCGGCCATGGG + Intronic
1134849799 16:17470619-17470641 CGGCGGGGAGCAGCCGCCCCCGG - Exonic
1134849803 16:17470639-17470661 CGCGGGGGCGCAGCGGTCGGCGG - Exonic
1136417305 16:30112072-30112094 CTCTGGGGAGGAGGGGCCCCTGG + Intronic
1136617069 16:31404701-31404723 CTCTGGGGAGCAAAGGCTGCTGG - Intronic
1137594498 16:49714848-49714870 GGCTGGAGAGCAGGGGCCGCGGG - Intronic
1138572352 16:57884096-57884118 CGCAGGGGCGCAGCGGGCGCTGG + Exonic
1138656377 16:58493996-58494018 GGCTGGGGAGGAGCGGGGGCTGG - Intronic
1140196236 16:72857974-72857996 GGCTGAGGAGCAGCGGGCCCTGG - Intronic
1141699511 16:85636030-85636052 CAGTGGGGACCAGCGGCCTCTGG - Intronic
1141737106 16:85861050-85861072 GGTTGGGGAGCAGAGGCTGCAGG + Intergenic
1142206240 16:88784579-88784601 CGCTGCGGAGAGGAGGCCGCCGG - Intronic
1142315210 16:89339798-89339820 CGCTGAGGAGCAGCCACAGCAGG - Intronic
1142356738 16:89604938-89604960 GGGTGGGGAGCAGCGGCTGCGGG + Intergenic
1143749973 17:9021218-9021240 CGTGGGGGAGGAGGGGCCGCCGG - Intergenic
1144950802 17:18992461-18992483 TGCTGGGGGGCAGTGGCCACAGG - Intronic
1145014016 17:19385280-19385302 CCCTGGGGAGGAGGGGCAGCTGG + Exonic
1145031451 17:19507766-19507788 CGCAGGGGAGAAGGGGACGCCGG - Intronic
1145031457 17:19507783-19507805 CGCAGGGGAGAAGGGGACGCAGG - Intronic
1145810026 17:27759036-27759058 CGCTGGCCAGCTGCTGCCGCAGG + Exonic
1146398510 17:32486814-32486836 CGCCGGGGAGTCGCGGCCGTTGG - Exonic
1147967305 17:44200088-44200110 TGCTGCCGAGCTGCGGCCGCGGG - Intronic
1148934308 17:51152501-51152523 CGCTGGAAAGCAGCGGCGGGAGG - Intergenic
1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG + Exonic
1149678471 17:58487657-58487679 CGGCGGGGAGCAACCGCCGCTGG - Intronic
1149996693 17:61409567-61409589 CCCCGGGGTGCAGCTGCCGCCGG - Intergenic
1150438850 17:65175552-65175574 TGCTGGGGAGCAGTGGTCTCGGG + Intronic
1150721126 17:67615113-67615135 CCCTGGGGAGCAGGGGCCCGTGG + Intronic
1152033228 17:77856531-77856553 CTCTGGGGAGGAGGGGCAGCTGG - Intergenic
1152808991 17:82372253-82372275 GGCAGGGGGACAGCGGCCGCCGG - Intergenic
1152809473 17:82374771-82374793 CGCTGCGGTGCTGCGGCCGCTGG + Exonic
1154268191 18:12897036-12897058 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
1155877093 18:31101583-31101605 CGCCGGGGAGCAGGGTGCGCCGG - Intronic
1156008461 18:32470535-32470557 CGCCGGGCAGCTCCGGCCGCGGG + Intergenic
1156495831 18:37524732-37524754 GGCTGGGGAGCAGGGGCTGTGGG - Intronic
1156502375 18:37567595-37567617 GGCTGGGGAGCTGGGGCGGCGGG + Intergenic
1160071794 18:75635412-75635434 AGCTGGAGAGCAGCGCCAGCTGG - Intergenic
1160179382 18:76620561-76620583 CGCTGCCGAGAAGCTGCCGCGGG - Intergenic
1160406784 18:78651797-78651819 AGGTGGGGAGCTGGGGCCGCTGG + Intergenic
1160706854 19:533897-533919 GGCTGGGCAGCAGCGGCCCTGGG - Intronic
1160790310 19:920007-920029 AGGTGGCGAGCAGCGGCAGCAGG - Exonic
1160796786 19:949303-949325 ACCTGGGGAGCAGCAGCCGCAGG + Intronic
1160806778 19:995401-995423 CGCTGGGTGGCAGCGTCCCCAGG - Intronic
1161101852 19:2425411-2425433 CACTGGGTAGAAGCGGCGGCAGG - Exonic
1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG + Exonic
1162152203 19:8654732-8654754 GGCTTGGGAGCAGCGGCACCTGG - Intergenic
1164639361 19:29812632-29812654 CGTGGGGGAGGGGCGGCCGCGGG + Intronic
1164658545 19:29942331-29942353 CGCTGCGGGGCGGCGGCGGCGGG + Exonic
1165319018 19:35074609-35074631 CTCTGAGGAGCTGCGGCTGCTGG + Intergenic
1165755154 19:38288617-38288639 CGGTGGGTAGCAGCTGCCGGGGG - Intronic
1166982297 19:46638662-46638684 TGCTGGGGAGCGGGGGACGCTGG - Intergenic
1167429061 19:49443816-49443838 CGCTGAGGCTCAGAGGCCGCTGG - Intergenic
1168108905 19:54181044-54181066 CGCGGCGCAGCAGGGGCCGCAGG + Exonic
925368342 2:3326024-3326046 CACTGGGGAGCAGCCGCCTCAGG - Intronic
926145806 2:10396633-10396655 TGCTGGGGTGCAGCGGCCTTGGG + Intronic
926843071 2:17104740-17104762 TGCTGGAGAGCAGCAGCCCCTGG - Intergenic
927207425 2:20619076-20619098 GGCTGGGCAGCAGAAGCCGCAGG - Exonic
927280928 2:21305763-21305785 CCCTGGGGGCCAGCTGCCGCAGG + Intergenic
927472644 2:23386719-23386741 CGCTGGGCAGCGTCGGCCCCGGG + Intronic
928421369 2:31139569-31139591 GTCTGGGGAGCAGAGGCAGCGGG + Intronic
929075672 2:38077052-38077074 AGCGCGGGAGGAGCGGCCGCAGG - Intronic
929947543 2:46382085-46382107 CAATGGTGAGCAGCGGCCACAGG + Exonic
930071473 2:47369621-47369643 GGCTGGGGGGCAGCGGCCCCCGG + Intronic
930358252 2:50346961-50346983 CGCCGAGGGGCAGCCGCCGCGGG + Intronic
931614706 2:64144245-64144267 CGCTGAGGAGCCGCGGACGCAGG + Exonic
933666698 2:84970779-84970801 CGCCGGTGAGCAGCGGGAGCCGG + Intergenic
933911143 2:86942428-86942450 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
933911194 2:86942602-86942624 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935591862 2:104852460-104852482 CGCAGCCGAGGAGCGGCCGCCGG - Intergenic
935775148 2:106466400-106466422 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775170 2:106466490-106466512 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775191 2:106466580-106466602 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775205 2:106466648-106466670 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775228 2:106466738-106466760 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775250 2:106466828-106466850 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775274 2:106466918-106466940 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775324 2:106467129-106467151 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775338 2:106467197-106467219 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775361 2:106467287-106467309 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775382 2:106467377-106467399 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775405 2:106467467-106467489 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775449 2:106467647-106467669 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775470 2:106467737-106467759 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775491 2:106467827-106467849 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935775512 2:106467917-106467939 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
935904354 2:107827276-107827298 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904377 2:107827366-107827388 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904400 2:107827456-107827478 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904423 2:107827546-107827568 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904550 2:107828046-107828068 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904580 2:107828161-107828183 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904610 2:107828276-107828298 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904656 2:107828456-107828478 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904679 2:107828546-107828568 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904709 2:107828661-107828683 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904783 2:107828956-107828978 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904806 2:107829046-107829068 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904829 2:107829136-107829158 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904853 2:107829226-107829248 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904898 2:107829406-107829428 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904919 2:107829496-107829518 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
935904941 2:107829586-107829608 CGCCTGGGAGCAGCGCCCGTCGG - Intronic
935991105 2:108719755-108719777 CGCCAGGGAGCAGCGCCCGTCGG - Intronic
936427314 2:112432902-112432924 CGCCAGGGAGCAGCGCCCTCGGG + Intronic
936427340 2:112432991-112433013 CGCCAGGGAGCAGCGCCCTCGGG + Intronic
936427368 2:112433080-112433102 CGCCAGGGAGCAGCGCCCTCGGG + Intronic
936427393 2:112433169-112433191 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
936427420 2:112433259-112433281 CGCCAGGGAGCAGCGCCCGTCGG + Intronic
938090405 2:128427578-128427600 CTCTGGGGGGCAGCAGCAGCTGG + Intergenic
938303405 2:130231538-130231560 CCCTGGGGAGCTGCAGCGGCTGG + Intergenic
938453268 2:131442694-131442716 CCCTGGGGAGCTGCAGCGGCTGG - Intergenic
940300894 2:152175711-152175733 GTCTAGGGAGCCGCGGCCGCGGG - Exonic
944221724 2:197310404-197310426 CGGAGGGGAGCTGCCGCCGCGGG + Intronic
946692429 2:222319530-222319552 GGCGGGGCAGCAGCGGGCGCGGG + Intergenic
947588208 2:231370081-231370103 CGCTGTGGAGCCGGGGCGGCTGG - Intronic
947598148 2:231426965-231426987 AGCTGGGGAGCAGAGCCCACAGG + Intergenic
948399127 2:237670324-237670346 TGCTGGGGAGCAGCGGCCCTAGG + Intronic
948751671 2:240136706-240136728 CCCAGGGGTGCAGCGGCCGTGGG - Intronic
948840661 2:240647275-240647297 CGCTCGGGACCAGGGGCCGCTGG - Intergenic
948870436 2:240795226-240795248 TACTGGGGAGCAGAGGCTGCTGG + Intronic
1172126597 20:32628206-32628228 GGCTAGGGAGCAGTGGCCGGGGG + Intergenic
1175878583 20:62243431-62243453 CGCTGCGGGGCAGGGGCTGCGGG - Intronic
1178350227 21:31867604-31867626 TGCTGGGAAGCAGCTGCCGGAGG + Intergenic
1178400175 21:32278771-32278793 GGCTGCGGAGGAGAGGCCGCTGG - Exonic
1179654734 21:42837968-42837990 CGCAGGGAAGCAGCGCCCTCAGG - Intergenic
1179833441 21:44012502-44012524 CTCTGAGGAGCCGCTGCCGCCGG + Exonic
1179979456 21:44888663-44888685 CGCTGGGGTGCAGCGGGGACCGG - Intronic
1179988268 21:44932799-44932821 CGCGGGGAAGCAGCGCCCTCAGG + Intronic
1181169852 22:21001976-21001998 CCTTGGGGAGGAGCGGCGGCTGG - Exonic
1181514378 22:23402698-23402720 GGCTGGGGAGCACGGGCCGGCGG + Intergenic
1183264527 22:36817185-36817207 CGCTGAGCAGCGCCGGCCGCCGG + Intronic
1183294019 22:37019460-37019482 GCCTGGGGAGCTGCGGCCGGGGG - Exonic
1183370101 22:37427332-37427354 CTCCGGGAAGCGGCGGCCGCGGG + Exonic
1183537729 22:38412973-38412995 CGCTGTGGAGCAGGGACCCCGGG + Intergenic
1184289229 22:43489431-43489453 CGCTGGGGAGCACCATCCCCAGG - Intronic
1184356232 22:43981257-43981279 CGATGGGGTGCAAGGGCCGCAGG - Intronic
1184640498 22:45867672-45867694 CGCTGGGGAGGAGGGCGCGCCGG - Intergenic
1184697911 22:46150250-46150272 CCCTTGGCTGCAGCGGCCGCGGG + Intergenic
1184716235 22:46283390-46283412 AGCTGGGGAGCAGCAGCCCCAGG - Intronic
1185056563 22:48581820-48581842 CGTTAGGGAGCAGCGCACGCAGG + Intronic
1185278280 22:49959213-49959235 CTCTGGGAAGCAGCGGCTGGAGG + Intergenic
949464750 3:4332969-4332991 GGCTGGGGAGAATCGGCCACTGG + Intronic
953694395 3:45146324-45146346 CGGTGGGGAGCGGCGGCCCCAGG + Exonic
954265883 3:49470112-49470134 CGCTGCGGAGCGGCCGACGCAGG + Exonic
955276996 3:57556296-57556318 AGCTGAGGAGCCGAGGCCGCCGG - Exonic
963236832 3:142964005-142964027 CACTGGGGAGCCGCGTTCGCGGG + Intergenic
968232974 3:197015213-197015235 GGGTGGGGAGGAGCGACCGCAGG - Intronic
968545189 4:1194629-1194651 GGCTGGGGAGCAGGTCCCGCGGG - Intronic
968618720 4:1594004-1594026 CGAGGGAGAGCAGGGGCCGCTGG + Intergenic
972311935 4:37890661-37890683 CCCTGGGGAGCCGGGGGCGCGGG - Intergenic
972533073 4:39977618-39977640 CGAGGAGGAGCAGCCGCCGCGGG + Exonic
975883550 4:78939230-78939252 AGCCGGGGAGCGGCGGCGGCCGG - Exonic
981782666 4:148444881-148444903 CGCTGCGGAGCGGCGGGCGCGGG - Intergenic
981782931 4:148445740-148445762 CGCAGAGGGGCAGCGGGCGCGGG - Intergenic
984952614 4:185018480-185018502 CGCAGGGGCGCAGCGGCCGCGGG - Intergenic
985064283 4:186105417-186105439 AGCAGGGGAGCAGCCCCCGCCGG - Intronic
985577458 5:680142-680164 AGCAGGGGCGCAGGGGCCGCGGG - Intronic
985592390 5:772238-772260 AGCAGGGGCGCAGGGGCCGCGGG - Intergenic
986402439 5:7394892-7394914 CGCGTGGGAGCGGAGGCCGCTGG - Intergenic
989099196 5:37808704-37808726 CCCTGGGGAGCAGGGGAGGCGGG - Intergenic
992124321 5:73625892-73625914 CGCTGCGGGGCTGCGGCCGTTGG - Intergenic
992473197 5:77077558-77077580 AGCTGGAGAGCAGCGGCGCCGGG - Exonic
992487587 5:77210869-77210891 CGCTGGGTCCCGGCGGCCGCGGG + Exonic
992716308 5:79514224-79514246 CGCCGCGGAGCCGCGGCCGGGGG + Intergenic
992837425 5:80654655-80654677 CGCCTGGGAACTGCGGCCGCGGG + Exonic
993901221 5:93585131-93585153 CGCCGGCGAGCAGCAGCAGCAGG + Exonic
997470642 5:134115167-134115189 CGCGGGGGAGGAGCCGGCGCCGG - Intronic
998531036 5:142884937-142884959 GGCTGGGGAGCAGCAGCAGTGGG - Intronic
999271998 5:150302237-150302259 GGCTGGGGCGGAGCGGCCGAGGG + Exonic
1002291744 5:178205041-178205063 CGCGGGGTAGGTGCGGCCGCGGG + Exonic
1003054213 6:2804325-2804347 CACTGGGGTGCACCGGCCTCAGG - Intergenic
1004044673 6:12012375-12012397 GACCGGGGAGCGGCGGCCGCCGG + Exonic
1004261145 6:14108932-14108954 CGCTGGGGAGCAGAGTCAGAAGG + Intergenic
1006136113 6:31897333-31897355 GGCTGGGGGGCAGCGGGTGCTGG - Intronic
1007429944 6:41770904-41770926 CCTTGGGGAGCCGCGGCGGCGGG + Exonic
1007606912 6:43123964-43123986 CACTAGGGAGCAGCGGAGGCAGG + Intronic
1016447727 6:144150419-144150441 CGCTGGGGCGCGGCGGCAGCCGG - Intergenic
1018389628 6:163332261-163332283 CCCTGGGGAGCAGGGGCAGTGGG - Intergenic
1018851676 6:167644903-167644925 CCCAGGGGAGCAGCGACCTCGGG + Intergenic
1019139966 6:169936891-169936913 GGCTGGGGGGCAGCGTCTGCAGG - Intergenic
1019350069 7:550394-550416 CACTGGGGAGCTGGGGCTGCAGG + Exonic
1019395419 7:815797-815819 GCCTGGGGAGGAGGGGCCGCGGG + Intergenic
1019624282 7:2008222-2008244 CACTGGAGAGCAGCTCCCGCAGG + Intronic
1020106247 7:5423538-5423560 CGGAGGGGAGCGGCGGCCGCGGG - Exonic
1021716688 7:23468732-23468754 GGTTGGGGAGCAGGGTCCGCTGG + Intronic
1022230716 7:28409969-28409991 CGCTGGGAAGCTGGGGACGCGGG - Intronic
1022289346 7:28986171-28986193 AGCTGGGGAGCGGGGGCCACAGG - Intergenic
1023845370 7:44117246-44117268 CCCTGGGGAGCAGTGGCATCAGG + Exonic
1024548878 7:50543953-50543975 CGGCAGGGATCAGCGGCCGCAGG + Exonic
1026010055 7:66629249-66629271 CGCGGGGGAGAAGCGGGCGCGGG + Intronic
1027050799 7:75020018-75020040 CTCTGGGGACCAGAGGCAGCTGG - Exonic
1027735011 7:81920850-81920872 AGCTGGGGAGCAGTGGGAGCAGG + Intergenic
1027978451 7:85186844-85186866 AGCCGGGAAGCTGCGGCCGCAGG + Intronic
1028121437 7:87059764-87059786 AGCTGGGGAGCAGGTGGCGCGGG + Intergenic
1028762310 7:94509841-94509863 CACGGCGGAGCAGCGGCGGCGGG + Exonic
1028914566 7:96243985-96244007 CACTGTGGAGCACGGGCCGCCGG + Intronic
1029503826 7:100950174-100950196 AGCTGGGGAGGAGCCGCCGGGGG - Intronic
1030210137 7:106987845-106987867 AGCTGGGCAGCAGTGGCCCCAGG + Intergenic
1033046563 7:137967684-137967706 CGATCGGGAGCAGGGGCCACAGG - Intronic
1034188372 7:149195972-149195994 CGGCGCGGAGCAGCGGTCGCCGG + Intronic
1034306366 7:150047991-150048013 CGCGCGGGAGGAGCGGTCGCCGG - Intergenic
1034415646 7:150963076-150963098 CCCTGGGGAGCTGGGGCCACTGG - Intronic
1034447863 7:151122613-151122635 GCCTGGGGAGCGGCGGCAGCGGG - Intronic
1034617934 7:152435530-152435552 CGCCGGGGCGCGGAGGCCGCGGG + Intronic
1034800480 7:154052651-154052673 CGCGCGGGAGGAGCGGCCGCCGG + Intronic
1035049538 7:155990548-155990570 AGCTGGGGAGAAGCCGCCCCTGG + Intergenic
1035580938 8:738628-738650 GGCTGGGGGGCGGCGGACGCGGG + Intergenic
1036453422 8:8889326-8889348 CGGAGGGGAGCAGCAGCCCCAGG + Intronic
1036786666 8:11692624-11692646 GGCTGAGGCGCAGAGGCCGCGGG - Intronic
1036810848 8:11867199-11867221 CTCTGGGGAGCAGTGGGTGCTGG - Intronic
1039463159 8:37762737-37762759 GGCTGTGGCGCGGCGGCCGCGGG + Exonic
1043388198 8:79768139-79768161 CGGGGAGGAGCCGCGGCCGCCGG - Intergenic
1045231402 8:100310158-100310180 CGCTGGGGCGGGGCGGCCGGGGG - Intronic
1045911274 8:107413321-107413343 GGCTGGGGAGCAGAGGGAGCAGG - Intronic
1047951564 8:129939708-129939730 AGCGGGGGAGCGGCGGCAGCCGG + Exonic
1047998529 8:130358425-130358447 CGCTGAGGAGCTGCCGCCGCCGG - Intronic
1049367034 8:142244817-142244839 CGCAGGGGAGCAGAGGGAGCAGG + Intronic
1049405685 8:142450963-142450985 CGCCGGTGAGCAGAGGCCGCCGG + Intronic
1049667421 8:143852463-143852485 CGCTGGGCAGCATGCGCCGCGGG - Intergenic
1049741355 8:144242540-144242562 CGCAGGGGAGCTGGGGCTGCCGG + Intronic
1049773442 8:144394159-144394181 CACTGGGGAGCAGAGGCCCAGGG + Exonic
1051079648 9:13279445-13279467 GACTGGGGAGCAGGGGTCGCCGG + Exonic
1053003766 9:34591443-34591465 CCCTGGGGAGGAGCGGCCCCCGG - Intergenic
1057205100 9:93167103-93167125 AGCTGGGGAGCATCTGCCCCAGG + Intergenic
1057488924 9:95507336-95507358 CGCCGGGGAGCAGCCTGCGCCGG - Intronic
1057900408 9:98943913-98943935 CGCTCGGCAGCGGCGGCGGCGGG - Exonic
1058686748 9:107487454-107487476 TGCTGGGGAGCTGCCGCCCCAGG + Exonic
1059119762 9:111631432-111631454 GGCTGGGGAGCCGGGGCTGCCGG + Exonic
1060096267 9:120793359-120793381 GGACCGGGAGCAGCGGCCGCAGG - Exonic
1060114475 9:120929220-120929242 GTCTGGGGAGCAGCAGCCCCGGG - Intergenic
1060219376 9:121756268-121756290 AGCAGGGGAGCAGCGGGCCCAGG + Intronic
1062098946 9:134718004-134718026 GGCTGGGGGGCCGCGGCCACGGG + Intronic
1062434127 9:136538993-136539015 TGATGGGCAGCAGCGGCCACCGG - Intronic
1062467414 9:136687401-136687423 CGCGGGGGAGAAGCGGGAGCGGG - Exonic
1062698619 9:137887966-137887988 CCCTGGGGAGCAGCTCCAGCAGG + Intronic
1190881503 X:54495515-54495537 CCCGGCGGAGCAGCGGCCTCAGG + Exonic
1191184258 X:57592637-57592659 TGCTGGGCAGGAGCGGCCCCTGG - Exonic
1191213135 X:57909822-57909844 TGCTGGGCAGGAGCGGCCCCTGG + Exonic
1192683150 X:73274706-73274728 CTCTGGGTAGCAGTGGCGGCAGG - Intergenic
1195923529 X:110003873-110003895 CTCTTGGCAGCAGCGGCTGCTGG + Exonic
1196789624 X:119452157-119452179 GGCAGGGGAGCAGCGGAGGCTGG - Intronic
1200065741 X:153503388-153503410 AGCTGGGCAGCAGGGGCCTCTGG - Intronic
1200077173 X:153556933-153556955 CACTGGTGAGCAGCGGCAGGTGG + Exonic
1200108115 X:153725500-153725522 CCCGGGGGAACAGCAGCCGCAGG - Exonic
1200216926 X:154372048-154372070 CGGTGGGAAGCAGCGGGCACAGG - Intronic
1202119971 Y:21511240-21511262 TGCTGGGGCGGAGCGGCCTCAGG + Intergenic
1202122422 Y:21534781-21534803 TGCTGGGGCGGAGCGGCCTCAGG + Intronic
1202156583 Y:21894602-21894624 TGCTGGGGCGGAGCGGCCTCAGG - Intronic
1202159031 Y:21918143-21918165 TGCTGGGGCGGAGCGGCCTCAGG - Intergenic
1202185480 Y:22183058-22183080 TGCTGGGGCGGAGCGGCCTCAGG - Intergenic
1202205880 Y:22403338-22403360 TGCTGGGGCGGAGCGGCCTCAGG + Intronic