ID: 1149300194

View in Genome Browser
Species Human (GRCh38)
Location 17:55298136-55298158
Sequence TGGGAGTCAGTTGGTTGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149300194_1149300204 20 Left 1149300194 17:55298136-55298158 CCTTATCAACCAACTGACTCCCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1149300204 17:55298179-55298201 CCCTGTTCAGGGGATTTATGTGG 0: 1
1: 0
2: 0
3: 9
4: 103
1149300194_1149300201 10 Left 1149300194 17:55298136-55298158 CCTTATCAACCAACTGACTCCCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1149300201 17:55298169-55298191 AGATTAGATCCCCTGTTCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 75
1149300194_1149300207 22 Left 1149300194 17:55298136-55298158 CCTTATCAACCAACTGACTCCCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1149300207 17:55298181-55298203 CTGTTCAGGGGATTTATGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 149
1149300194_1149300199 8 Left 1149300194 17:55298136-55298158 CCTTATCAACCAACTGACTCCCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1149300199 17:55298167-55298189 TCAGATTAGATCCCCTGTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 81
1149300194_1149300200 9 Left 1149300194 17:55298136-55298158 CCTTATCAACCAACTGACTCCCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1149300200 17:55298168-55298190 CAGATTAGATCCCCTGTTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 122
1149300194_1149300206 21 Left 1149300194 17:55298136-55298158 CCTTATCAACCAACTGACTCCCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1149300206 17:55298180-55298202 CCTGTTCAGGGGATTTATGTGGG 0: 1
1: 0
2: 0
3: 15
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149300194 Original CRISPR TGGGAGTCAGTTGGTTGATA AGG (reversed) Intronic
901777350 1:11569520-11569542 TGGGAGTCAGCTGGGTGGTGGGG + Intergenic
901974280 1:12932087-12932109 TGGGGGTCACTTGGATGACAGGG + Intronic
902010895 1:13269681-13269703 TGGGGGTCACTTGGATGACAGGG - Intergenic
902902016 1:19524160-19524182 AGGGCTACAGTTGGTTGATAAGG + Intergenic
905271653 1:36791420-36791442 TGGGAGTCACCTGGATGCTAAGG + Intergenic
907651047 1:56295136-56295158 TGGGAGCTACTTGCTTGATATGG - Intergenic
911855850 1:102873570-102873592 TGGGAGACAATTGAATGATAGGG - Intergenic
912234370 1:107833778-107833800 AGGGAGTCACTTGGATGACAAGG + Intronic
912634072 1:111274898-111274920 TGGGAGTCATTTGATGGGTACGG + Intergenic
916975510 1:170073896-170073918 TGGGAGTCAAATGGATGACATGG + Intronic
920826010 1:209424960-209424982 TGGGACTCAGTGGTGTGATATGG - Intergenic
922168491 1:223135411-223135433 AGGGAGTCAGCTAGTTGATTTGG + Intronic
922362547 1:224836614-224836636 TGGGAGTCTGTTGATAGACACGG + Intergenic
923849515 1:237778048-237778070 TGGGAGTCATTAGGCTGAGATGG - Intronic
1063671625 10:8103954-8103976 TGTGTGTCAGTTGGCTAATACGG + Intergenic
1064337119 10:14453688-14453710 TGGGAGTCAGTTTGGAGCTAAGG - Intronic
1065137378 10:22685501-22685523 TGGGTGTCACTTTGTTGATCAGG - Intronic
1066377396 10:34869811-34869833 TGGGAGGCATTTGGTTCATGGGG - Intergenic
1070316764 10:75321006-75321028 TGGGAGGCAATTGGATGATGGGG + Intergenic
1072518902 10:96213145-96213167 GAGGGGTCAGTTGGTTGAGAGGG - Intronic
1074338568 10:112603754-112603776 TGGGAGGGAGTGGGTTGCTAAGG - Intronic
1080230624 11:30015417-30015439 TGGGAGTCAGTTGGGTGGGAAGG - Intronic
1080577693 11:33614981-33615003 TGGGAGACAGTTGTTTTAAAAGG - Intronic
1086454831 11:86950996-86951018 TGGGAGGCAGTGGGTTGACGGGG + Exonic
1090080623 11:123609865-123609887 TGGGAGCCAGAGGGTTGGTAAGG - Exonic
1091992619 12:4968375-4968397 TGGTAGTGAGTTGGTTGGCATGG + Intergenic
1092056807 12:5514175-5514197 TGGGGCTCAGTTGGCTAATATGG - Intronic
1096851221 12:54438974-54438996 TGGGAGTCAGTAGGATAAAATGG - Intergenic
1101584052 12:106068723-106068745 TGAGAGTCAGTTGGTTCCTGTGG - Intronic
1104486588 12:129156333-129156355 TGGGAGTGAGTTGGTTATCATGG - Intronic
1104922291 12:132296885-132296907 TGGGAGTGAGTTGGTTTGTGTGG - Intronic
1104922330 12:132297167-132297189 TGGGAGTGAGTTGGTTATCATGG - Intronic
1104922440 12:132298053-132298075 TGGGAGTGAGTTGGTTATCATGG - Intronic
1108005120 13:45938502-45938524 TGGGAGGTGGTTGGATGATAGGG + Intergenic
1109326471 13:60873298-60873320 TGTGAGTCAGTGTGTGGATAGGG + Intergenic
1109843135 13:67947556-67947578 TGGGAATCAGTTTTTTTATAAGG - Intergenic
1113522337 13:110949774-110949796 TGGGAGGCAGTTGAATCATAGGG + Intergenic
1116063595 14:39954669-39954691 TGGTAGGCAGTTTGTTAATAAGG + Intergenic
1118669871 14:68112408-68112430 TAGGAGTCACTTGATTCATAGGG + Intronic
1121162676 14:91759672-91759694 TGGGAGTTAGATGCCTGATATGG + Intronic
1121524482 14:94609909-94609931 CTGGAGGCAGTGGGTTGATATGG - Intronic
1123944393 15:25231981-25232003 TGGGAGTGGGTTGGTTGCTGTGG + Intergenic
1126074518 15:44896361-44896383 TGCTGGTCAGTTGGTTGCTAAGG + Intergenic
1127473755 15:59313293-59313315 TGGCAGTCAGGTGGCTGATTTGG - Intronic
1127714405 15:61635021-61635043 TGAGAGTCAAGTGGCTGATATGG + Intergenic
1129954957 15:79627938-79627960 TGGAAGTTTGTTGGTTGATACGG + Intergenic
1130821812 15:87503771-87503793 TAGGAGTCAGTTGATTGTAAAGG + Intergenic
1136623305 16:31444269-31444291 TGTTAGTCAGTTGGTGGCTATGG + Intergenic
1137005663 16:35272720-35272742 TGTGAGTCAGTGGGCTGAGAGGG - Intergenic
1137352634 16:47726952-47726974 TGGGAGCCAGTGGATTGAAATGG + Intergenic
1137865245 16:51888214-51888236 TGGGAGTCATGTGGATGATTGGG + Intergenic
1140542162 16:75766713-75766735 TGGGACTCAGTTTGTTGATGTGG + Intergenic
1142703882 17:1682062-1682084 TGGGAGGCAGTGGGTAGAAATGG - Intronic
1143583070 17:7837457-7837479 GGGGACTCAGTTGATTGCTATGG + Intergenic
1147531323 17:41280808-41280830 TGGGAGTTAGTTCATTGGTAAGG - Intergenic
1147627474 17:41909393-41909415 TGGGAGCCAGGTGGTAGACACGG - Intronic
1149037093 17:52146876-52146898 TGGGAGTCACAAGGTTGATGGGG - Intronic
1149300194 17:55298136-55298158 TGGGAGTCAGTTGGTTGATAAGG - Intronic
1155560026 18:27065689-27065711 TGGTAGTCAGTTGGATCCTAAGG + Intronic
1163322419 19:16582524-16582546 GGGGGGTCAGTTGGTTGTTAAGG - Intronic
1163423978 19:17230814-17230836 TGGGCTTCACTGGGTTGATACGG - Intergenic
925405948 2:3605525-3605547 GGGGAGTCACGTGGTTGATGAGG + Intronic
929510535 2:42562806-42562828 TGGGAAACAGTTGGATGAAAAGG - Intronic
930732298 2:54739720-54739742 TGGGAGGCGGTTGGTGGTTAGGG + Intronic
935145062 2:100390088-100390110 TGGGTGTCATTTGGGTAATAGGG - Intergenic
935926192 2:108072302-108072324 TGGGACTCAGTTTCTTCATATGG - Intergenic
937478058 2:122232540-122232562 TAGGAGTCAGTGTGTTGATGGGG - Intergenic
937767852 2:125682113-125682135 AAAGAGTCAGTTGATTGATATGG + Intergenic
938561373 2:132475130-132475152 TGGGATTCAATTAGCTGATAAGG - Intronic
938591231 2:132738113-132738135 AGGGAGTCAGTTGTTTGCTTTGG - Intronic
938728035 2:134123803-134123825 TGGGTGACAATTGGGTGATAGGG + Intronic
941698141 2:168575496-168575518 TGGGAGCCAATTGGTTCATGGGG - Intronic
947057331 2:226120971-226120993 TGGGACTCAGCTGATGGATAAGG + Intergenic
948271244 2:236674701-236674723 TGGGAGTCAGTAGCTTCCTAAGG + Intergenic
1173066104 20:39713632-39713654 TGGGAAGCAGATGGGTGATAGGG + Intergenic
1173390746 20:42630312-42630334 TGGGAGTCAGATGTCTGAAATGG - Intronic
1175244638 20:57574375-57574397 TGGGAGTCAGTTTGTCCATGAGG - Intergenic
1178405022 21:32316782-32316804 TGGCAGTCAGTTGGGTGCTGCGG - Exonic
1179280500 21:39930063-39930085 TGGGAGCCAGTTGGTTGGGTGGG + Intergenic
1183836223 22:40455697-40455719 TGGGAGTCAGCAGGATGACAGGG + Intronic
949734828 3:7160085-7160107 TGGGAGTCATTTTGTTGAGTAGG + Intronic
952122901 3:30265848-30265870 TGGGAGGCATTTGGGTCATAGGG + Intergenic
952472395 3:33669856-33669878 TTGGAGGCATTTAGTTGATATGG - Intronic
955552784 3:60101804-60101826 TGGGAGAGCGCTGGTTGATAAGG - Intronic
957050885 3:75410989-75411011 TGGGAGGCAGTTGGATCATGAGG + Intergenic
957271604 3:78037354-78037376 TGGGAGTCAGATGTTAGCTAGGG - Intergenic
958563302 3:95776497-95776519 TGGGAGGCAATTGATTGATGGGG + Intergenic
960157930 3:114317034-114317056 TTGGTGTCAGTTGGTGGAGAAGG - Intergenic
960399648 3:117180545-117180567 TGTCAGTGAGATGGTTGATATGG - Intergenic
961195792 3:125000258-125000280 TGGGAGTCAGAGGGTGGGTAGGG + Intronic
961481319 3:127182869-127182891 TGGGAGTCAGTTGGGTGGAGGGG - Intergenic
962300398 3:134236528-134236550 TGGGAGTCAGAAGTTTGATAGGG - Intronic
964638548 3:158884303-158884325 TGGAGGTCAGTTGGATGATGAGG + Intergenic
965864483 3:173189086-173189108 TGGGAGTGGGTTAGTTGATGTGG + Intergenic
966633679 3:182108023-182108045 TGGGAGTCATTTCTTTGATTTGG - Intergenic
967806100 3:193715766-193715788 TGGGAGATAGTTGGGTCATAGGG + Intergenic
971499623 4:27304486-27304508 TGGGAGGTAGTTGGATCATAGGG - Intergenic
972749224 4:41972115-41972137 TGGGAGTCATTTGAATCATAGGG + Intergenic
975426550 4:74235671-74235693 TTGAAGTGTGTTGGTTGATATGG + Intronic
975521793 4:75309737-75309759 TGGGAGACATTTGGGTCATAGGG + Intergenic
976785219 4:88811966-88811988 TGGGAGTGGGTTGGTTAGTATGG + Intronic
987118773 5:14747149-14747171 TGGGAGTGAGTTGGGTTGTAAGG - Intronic
988698480 5:33648515-33648537 AGGGATTAAGTTGGTTGCTATGG + Intronic
989762522 5:45035386-45035408 TGGGAGGCAGTCTGTGGATAAGG + Intergenic
995536605 5:113142931-113142953 TGGTCCTCAGTTTGTTGATAAGG - Intronic
998557886 5:143143354-143143376 TCGGAGTCACTTGGTAAATATGG + Intronic
998576965 5:143327315-143327337 TGGGAGGCAGTTGGATCATGGGG - Intronic
1006065405 6:31457850-31457872 TGGGAGTGAGTAGGTGGCTAAGG + Intergenic
1008030903 6:46692730-46692752 TTGGTGTCAGTTTGCTGATACGG + Exonic
1011493826 6:87919633-87919655 TGGGAAACAGCTGGTTGAGAAGG + Intergenic
1012900057 6:104994765-104994787 TGTGAGACAGTTGGTTGAAGAGG + Intronic
1013790245 6:113828138-113828160 TGGAAGTAGGGTGGTTGATATGG - Intergenic
1023376618 7:39562459-39562481 TGGGAGTTAATTGGATCATAGGG - Intergenic
1024049003 7:45606237-45606259 TGGGAGTGGGTGGGTTGATTGGG + Intronic
1026207754 7:68272967-68272989 TGGGATTCAGTGGTTTGATCAGG + Intergenic
1027126774 7:75562225-75562247 TGTGGGTCAGTTGAGTGATATGG + Intronic
1028244581 7:88461812-88461834 TGGGCTTCAGTTGGGTGATTTGG - Intergenic
1030382833 7:108832442-108832464 TGGAAGTCAGTAGGCTGAGATGG + Intergenic
1030628154 7:111866567-111866589 TGGGAGTCAGTGTGTTGAAGAGG + Intronic
1035593062 8:832904-832926 TGGGAGTCAGTTCTTTGTAATGG + Intergenic
1035777747 8:2202684-2202706 TGGGGGTCAGTTGATTAATGGGG + Intergenic
1036217768 8:6895029-6895051 TGGGAGTCAGTGGCTTGCCAAGG - Intergenic
1036782529 8:11659387-11659409 TGGGAGTCAGAGGGTGGAGATGG - Intergenic
1038097506 8:24331276-24331298 TGGGAACCAGTTGGTGGAAATGG + Exonic
1039291615 8:36101310-36101332 TGGGCTTCAGTTGGGTGATTTGG + Intergenic
1039306638 8:36270269-36270291 TGGCAGTCAGTTGGAAGATGTGG + Intergenic
1045603079 8:103740359-103740381 TGGCAGTCAGATGGTAGAGAAGG + Intronic
1051423235 9:16909502-16909524 TGGGAGTCCATTAGTTGAGATGG - Intergenic
1055171821 9:73267449-73267471 TGGGAGGCATTTGGGTAATATGG + Intergenic
1055531423 9:77188001-77188023 TGGGAGGCAGTTGGGTCATAGGG + Intronic
1058820518 9:108725189-108725211 TGGGAATGAGTGGGTTGATGGGG - Intergenic
1059235605 9:112758280-112758302 TGGGAGTGAGCTGGTTGAGAGGG - Intronic
1061502714 9:131013016-131013038 TGGGAGTCAGTGGGGTGTTGGGG + Intronic
1062299737 9:135858954-135858976 TGTGAGTCAGTGGCTTGAGAAGG - Intronic
1185767269 X:2735818-2735840 TGGGAGTCATTTAGTGGTTAGGG + Intronic
1186545771 X:10447819-10447841 AGGGAGGCAGTTGGTTGATTTGG + Exonic
1186633331 X:11374879-11374901 GGGGAGTCAGTAGGATGGTAGGG - Intronic
1187189929 X:17024501-17024523 TGGGAGTAAGCTGGTTGGAATGG + Intronic
1190917581 X:54821766-54821788 TGGGAGTCATTTGGTGGCTGGGG + Intergenic
1192450734 X:71243191-71243213 TGGGAAACAGTTGCTTGATTAGG + Intronic
1192592800 X:72374923-72374945 TGGGAGGCAGTAGGTGGAGAGGG - Intronic
1194542260 X:95189576-95189598 TGGGAGACAATTGATTCATAGGG - Intergenic
1194845668 X:98805015-98805037 AGGGAGTAAGTTGATTCATATGG - Intergenic
1197958747 X:131980798-131980820 TGGAAGTCAGTTGTTTGCCAAGG - Intergenic
1198230837 X:134687586-134687608 TGAGAGTCTGCTGGTTGCTAGGG + Intronic