ID: 1149300199

View in Genome Browser
Species Human (GRCh38)
Location 17:55298167-55298189
Sequence TCAGATTAGATCCCCTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149300194_1149300199 8 Left 1149300194 17:55298136-55298158 CCTTATCAACCAACTGACTCCCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1149300199 17:55298167-55298189 TCAGATTAGATCCCCTGTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 81
1149300196_1149300199 -1 Left 1149300196 17:55298145-55298167 CCAACTGACTCCCATGATTAGGT 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1149300199 17:55298167-55298189 TCAGATTAGATCCCCTGTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149300199 Original CRISPR TCAGATTAGATCCCCTGTTC AGG Intronic
902457352 1:16544650-16544672 TCAGATTAGAACCCAGGTTGTGG + Intergenic
902483867 1:16728617-16728639 TCAGATTAGAACCCAGGTTGTGG - Intergenic
902494815 1:16863262-16863284 TCAGATTAGAACCCAGGTTGTGG - Intronic
904600682 1:31671118-31671140 CCAGAGTAGATACCCTGGTCTGG + Intronic
908823423 1:68111785-68111807 GCAGATGAGATGCTCTGTTCTGG + Intronic
913662340 1:121015541-121015563 TCAGATTAGAACCCAGGTTGCGG + Intergenic
914013720 1:143798726-143798748 TCAGATTAGAACCCAGGTTGCGG + Intergenic
914164104 1:145162461-145162483 TCAGATTAGAACCCAGGTTGCGG - Intergenic
914652343 1:149707335-149707357 TCAGATTAGAACCCAGGTTGCGG + Intergenic
915714403 1:157930891-157930913 TCAGACTGGATCCCCTCATCCGG - Intergenic
916586016 1:166150999-166151021 CCAGATTAAAACCCCAGTTCTGG - Intronic
922559119 1:226555279-226555301 CCAGTTTAGATCCCCAGCTCAGG + Intronic
923077371 1:230622179-230622201 TCTGAATAAATCCCCTGTCCTGG + Intergenic
1063038854 10:2316447-2316469 TCAGATCAGATTCCCTGATCTGG - Intergenic
1064149158 10:12848730-12848752 TCAGGTTAATTTCCCTGTTCAGG + Intergenic
1065498335 10:26352931-26352953 TCAGAACAGATCCCTTGTTCAGG + Intergenic
1069046707 10:63750908-63750930 TCAGATTTGGTCCCCTGGTCTGG + Intergenic
1072049878 10:91692898-91692920 ATAGATTTGATCCTCTGTTCTGG + Intergenic
1075312354 10:121425093-121425115 TCAGCTTAGCTCCCCAGTTGCGG - Intergenic
1076813583 10:132902236-132902258 TCAGGTTAGACCCCCTGCTATGG + Intronic
1079382092 11:19947283-19947305 TCAGATTGGACCCCTTGTTTTGG - Intronic
1081188747 11:40077956-40077978 TCAGATTATCTCCCTTTTTCTGG - Intergenic
1085282186 11:75338406-75338428 TCAGTTTGGATCCCCTGAACTGG + Intronic
1093908044 12:24714999-24715021 ACAGATCAGATCCCCTGTGAGGG - Intergenic
1094734647 12:33221430-33221452 TCAGATTAGCTTCCCTTTTTAGG + Intergenic
1096625877 12:52895797-52895819 CCAAAATAGATCCCCTGCTCTGG + Intergenic
1102657932 12:114499003-114499025 CCAGTTGAGATCCACTGTTCTGG - Intergenic
1106899564 13:34340832-34340854 TGACATTAGATCCCCAGTGCTGG - Intergenic
1109900837 13:68767332-68767354 TCAGATTAGATCCCCATCACTGG - Intergenic
1110330665 13:74268608-74268630 TGAGATTGGAACTCCTGTTCAGG + Intergenic
1111159729 13:84378533-84378555 TCAAATTAGATCCCCAGTTTTGG - Intergenic
1113898320 13:113780166-113780188 CCAGATCAGAACCCCTGTGCAGG + Intronic
1116342042 14:43736282-43736304 TGAAATTAGATCCTCTGTTTTGG + Intergenic
1121196943 14:92081935-92081957 TCAGTTTATATTCCCTGTCCAGG + Intronic
1121947976 14:98141404-98141426 TCATATTAAATACCCTGATCAGG + Intergenic
1125356091 15:38818599-38818621 TCAGATTAGACCCCCTCTCAGGG + Intergenic
1128282501 15:66408173-66408195 CAAGATTAGATCCCCAGTGCAGG + Intronic
1132103096 15:99041720-99041742 TCAGATTTGATCCCTTGGTTTGG - Intergenic
1132901853 16:2260532-2260554 TCAGATTAGAAACCCTGTACAGG - Intronic
1137385628 16:48040150-48040172 ACAGATTGGGTCCCTTGTTCTGG + Intergenic
1137824185 16:51475675-51475697 TGAGAGTAGATTCCCTGTACTGG + Intergenic
1138789887 16:59890913-59890935 TCAGCGTAGATGACCTGTTCTGG + Intergenic
1146708378 17:35019208-35019230 TCTGCTTACATCCCCTGTTCTGG - Intronic
1149300199 17:55298167-55298189 TCAGATTAGATCCCCTGTTCAGG + Intronic
1149951430 17:60991503-60991525 TGACATTAGATCACCTTTTCTGG + Intronic
1150344883 17:64397029-64397051 TCTGATTAGTTTCCATGTTCTGG + Intronic
1164772515 19:30821059-30821081 TCAGCTTAGATGCCGTGATCTGG - Intergenic
926185643 2:10688698-10688720 TCAGATAAGGTTCCCTGTTGGGG - Intronic
938400811 2:130989821-130989843 CCAGATTAGATAACCTGCTCAGG - Intronic
944361642 2:198864175-198864197 TCATATAAAATCCCCTTTTCAGG - Intergenic
947943182 2:234076359-234076381 TCAGCTTACATGCCCTCTTCAGG + Intronic
1172261032 20:33565467-33565489 TCATATGAAATCCCCTTTTCAGG - Intronic
1174131854 20:48350565-48350587 TCAGTTCAGTTCCTCTGTTCTGG - Intergenic
1174704586 20:52642607-52642629 TCAGGTCAGATGCCCTGCTCAGG + Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
951036430 3:17937888-17937910 TCAGAGTAGCTTCCCTGTACTGG + Intronic
961940054 3:130627635-130627657 TAAGATTACATGCACTGTTCAGG - Intronic
962277746 3:134029051-134029073 TCAGATTGGCTTCCCTGGTCTGG - Intronic
963446000 3:145408501-145408523 CCAGATTAGGTCCCCTTTTGTGG - Intergenic
974295692 4:59995819-59995841 ACAGATTAGAAACCCTGTACAGG + Intergenic
975370720 4:73583943-73583965 TCAGATTGGATCACTTGTGCTGG - Intronic
975852457 4:78586693-78586715 TCAGATTAGATCCACGATTTTGG + Intronic
987826806 5:23041227-23041249 ACAGATTTCTTCCCCTGTTCTGG + Intergenic
990232317 5:53727003-53727025 TCAGGTTAGATTCCTTGTTTGGG - Intergenic
997851259 5:137334666-137334688 TAAGATGAGGTCCCCTGTTGAGG + Intronic
1002719346 5:181248225-181248247 TCAGCTTAGGTTGCCTGTTCAGG + Intergenic
1006872298 6:37262698-37262720 ACAGCATAGATCACCTGTTCTGG + Intronic
1009195278 6:60677264-60677286 TCAAATTACATCCTCTGTTTTGG + Intergenic
1015851285 6:137575167-137575189 CCAAGTTAGATGCCCTGTTCTGG - Intergenic
1023387443 7:39674219-39674241 ACAGATTAGAGCCGCTGTACTGG + Intronic
1024707858 7:51980743-51980765 TCAGAGAAGACCTCCTGTTCTGG + Intergenic
1040495912 8:47965551-47965573 TCAGACAAGCTACCCTGTTCTGG - Intronic
1040991002 8:53349271-53349293 ACAGATTAGAAACCCTGTACAGG + Intergenic
1046385442 8:113502766-113502788 GCAGATTAGAAACCCTGTACAGG + Intergenic
1051001064 9:12282159-12282181 TCAGAATAGATCTCCTTTTAGGG - Intergenic
1059187477 9:112288077-112288099 TCAGATTAGCTACACTGTTTTGG + Intronic
1189132541 X:38515278-38515300 TCAGATCAAATACCCTGTTTGGG + Intronic
1197153489 X:123245407-123245429 TGAGATTAGATCCCCTTGCCTGG + Intronic
1199917184 X:152356033-152356055 TCAGATTAGATGCTCTCTACAGG + Intronic
1200685109 Y:6250990-6251012 TCACATGAGATCCCTTCTTCTGG + Intergenic
1200990635 Y:9342260-9342282 TCACATGAGATCCCTTCTTCTGG + Intergenic
1200993297 Y:9362577-9362599 TCACATGAGATCCCTTCTTCTGG + Intronic
1200995957 Y:9382848-9382870 TCACATGAGATCCCTTCTTCTGG + Intergenic
1200998619 Y:9403200-9403222 TCACATGAGATCCCTTCTTCTGG + Intergenic
1201001129 Y:9471730-9471752 TCACATGAGATCCCTTCTTCTGG + Intronic
1201003793 Y:9492058-9492080 TCACATGAGATCCCTTCTTCTGG + Intergenic
1201006447 Y:9512339-9512361 TCACATGAGATCCCTTCTTCTGG + Intergenic
1201009104 Y:9532648-9532670 TCACATGAGATCCCTTCTTCTGG + Intergenic