ID: 1149301959

View in Genome Browser
Species Human (GRCh38)
Location 17:55313535-55313557
Sequence CTGTGTAAGAATGGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 294}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149301959 Original CRISPR CTGTGTAAGAATGGGGAGGT GGG Intronic
900024706 1:261000-261022 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
900028315 1:350405-350427 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
902869396 1:19304633-19304655 CTGTGTAAAAATGGCTAAGTTGG + Intronic
905649625 1:39647564-39647586 CAGTGGCAGAATAGGGAGGTCGG - Intergenic
906131917 1:43465302-43465324 CAGGGTAAGACTGGGAAGGTGGG - Intergenic
906535391 1:46548472-46548494 CTGGGATAGAATGGGGAGGGGGG - Intronic
906559825 1:46748344-46748366 CAGTGACAGAATTGGGAGGTAGG - Intergenic
908137780 1:61150851-61150873 ATTAGTAAGAATGGGGAGGGAGG + Intronic
909285609 1:73813247-73813269 GTGTGTATGGAGGGGGAGGTTGG - Intergenic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
909698588 1:78494425-78494447 GTCTGTAACAATGGGGAAGTGGG + Intronic
911538965 1:99135493-99135515 CTGAGAAAGAATTGGCAGGTGGG - Intergenic
916567048 1:165990058-165990080 CTGTGGATAAATGGAGAGGTTGG + Intergenic
916749851 1:167714214-167714236 CTGGCTAAGAAAGGGGTGGTGGG - Intergenic
916774244 1:167943664-167943686 GAGTGGAAGAATGAGGAGGTGGG - Intronic
916902740 1:169247206-169247228 CTGTGTAAGATTGGGTAAATAGG + Intronic
916990576 1:170239640-170239662 CTGTGTATGGGTGGGGAGGGAGG + Intergenic
917526912 1:175796302-175796324 CTGGGTCAGGGTGGGGAGGTGGG - Intergenic
917854344 1:179089000-179089022 CTTTGTGAGGATGGGGAAGTTGG + Intronic
918555000 1:185788314-185788336 CTTTGTAAGAAGGAGAAGGTTGG - Intronic
918651422 1:186968034-186968056 ATGAGAAACAATGGGGAGGTGGG + Intronic
921394052 1:214650064-214650086 CTGTGGAATAATTGGGATGTGGG + Intronic
921407737 1:214799449-214799471 CTGTGTAAGGATGGGGAGTTGGG + Intergenic
923054195 1:230413285-230413307 CTGAGACAGAATAGGGAGGTTGG - Intronic
923145825 1:231196954-231196976 CTGTGTAGGGATGGGGTGGACGG + Intronic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
923678648 1:236101273-236101295 GTGTGTGTGAATGTGGAGGTGGG + Intergenic
924071517 1:240285165-240285187 ATGTCTGAGAATGGGGTGGTAGG + Intronic
924551843 1:245085476-245085498 CTGAACAAAAATGGGGAGGTAGG + Intronic
924956532 1:248933600-248933622 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1063116737 10:3076930-3076952 TTATGTAGGCATGGGGAGGTGGG - Intronic
1064124625 10:12649336-12649358 GTCTGAAAGAAAGGGGAGGTCGG + Intronic
1064438559 10:15332820-15332842 CTGTCTGAGAATGGCGAGGAAGG + Intronic
1064451417 10:15445369-15445391 ATGTGTAAGGATGGGGAGAGAGG - Intergenic
1066290922 10:34013806-34013828 CTGTTTTAGAATGGGGAAATGGG - Intergenic
1067668872 10:48301839-48301861 ATGTGTAAGATGTGGGAGGTGGG + Intergenic
1068177274 10:53477592-53477614 ATGTGTAAGCATGTAGAGGTGGG - Intergenic
1070118293 10:73550451-73550473 ATATGTAAGAGTGGGGAGTTTGG - Intronic
1072003341 10:91219159-91219181 CTGAGGATGAATGTGGAGGTGGG - Intronic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1073943077 10:108719819-108719841 CTGTGTAGGAAAGGGGACTTGGG - Intergenic
1074928908 10:118103427-118103449 CTGTCTAAGCATGGGTGGGTAGG + Intergenic
1075094128 10:119460099-119460121 CTGTATAAGACCGGGCAGGTGGG - Intergenic
1076534991 10:131171296-131171318 CCCTGAAAGAAGGGGGAGGTGGG + Intronic
1076610343 10:131722355-131722377 CTGAGCAGGAGTGGGGAGGTAGG - Intergenic
1076737514 10:132465411-132465433 CTGTGTAAGCACGGGGAGGGTGG - Intergenic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1077922885 11:6655098-6655120 ATGTGTCAGAATGTGGAGGATGG - Intronic
1078016784 11:7621740-7621762 CTTTGGGAGTATGGGGAGGTGGG + Intronic
1079279082 11:19072108-19072130 CTGTGGAAGACTGGGAAAGTCGG - Intergenic
1081789551 11:45773395-45773417 CTGTGTAAGTATGAGGTGGGTGG - Intergenic
1082273841 11:50200451-50200473 CTGTGTCAGGATGAGGAGATTGG - Intergenic
1083699118 11:64462942-64462964 CAGTGTAATAATAGTGAGGTAGG - Intergenic
1084815966 11:71646970-71646992 CTGTGGAAGAATAGGGACTTTGG - Intergenic
1084902712 11:72321707-72321729 CTGGGCAAGAATGGGAAGGTAGG + Intronic
1085346456 11:75771181-75771203 CTGTGGGAGTATGGGTAGGTGGG + Intronic
1085723838 11:78936806-78936828 GTGTGTTAGAATGAGAAGGTGGG + Intronic
1086838933 11:91660535-91660557 CAATGTAAGAATGGGGATGAGGG + Intergenic
1087083716 11:94196466-94196488 CTATGTAATAATGAGTAGGTTGG + Intergenic
1088918778 11:114246715-114246737 CTATGTAAGACTGTGGAGGAAGG + Intronic
1089265264 11:117254924-117254946 AGGTGTAAGAATGAAGAGGTGGG - Intronic
1091390590 12:123854-123876 ATTTATAAAAATGGGGAGGTTGG + Intronic
1092122498 12:6054289-6054311 CTCTGCAAGAATGGAAAGGTTGG + Intronic
1092247272 12:6870696-6870718 CGGTGTAAGAAGGGAGAGGATGG - Exonic
1093465253 12:19441719-19441741 CTGTGTAGGCATGGGTAGGAAGG + Intronic
1093873909 12:24326765-24326787 GTGTGTATGAATGGGTGGGTGGG - Intergenic
1094502464 12:31033515-31033537 CTGGGGAAGACTGGGGAGGTAGG + Intergenic
1094680116 12:32660339-32660361 GTGGGGAAGAAAGGGGAGGTAGG - Intergenic
1095103660 12:38206875-38206897 CTGTGTAACCATGGGAAAGTGGG - Intergenic
1096070199 12:48771106-48771128 CAGTGTAAGACTGAGGAGCTGGG + Intronic
1098588114 12:72179536-72179558 ATATGTAAAAATGGGGAAGTAGG - Intronic
1098600853 12:72330291-72330313 TTTTTTAAGAATTGGGAGGTGGG - Intronic
1099411509 12:82334675-82334697 CTGTGTGTGTATGGGGAAGTGGG - Intronic
1101055419 12:100907435-100907457 CTGTGGAAGCACGGGGAAGTAGG - Intronic
1101291026 12:103369551-103369573 GTGTGAAAGAATGGAGAGGCAGG + Intronic
1101434164 12:104650856-104650878 GTGGTTAAGAATGGGGACGTGGG + Intronic
1101654841 12:106710776-106710798 CTCTGTAAGAATGAAGAGCTAGG + Intronic
1104948744 12:132429279-132429301 ATGTGTGAAAATGGGGAAGTGGG - Intergenic
1107847844 13:44535922-44535944 ATGTGTATGAAAGGGTAGGTTGG - Intronic
1108009249 13:45987144-45987166 CGGTGGAAGGATAGGGAGGTAGG - Intronic
1108305181 13:49124335-49124357 CTGTGAAGGGATGGGGAGCTAGG + Intronic
1109299919 13:60580336-60580358 TTGTCTAAAGATGGGGAGGTAGG + Intergenic
1111389452 13:87573289-87573311 TTTTGAAAGAATAGGGAGGTAGG - Intergenic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1115695861 14:35898078-35898100 CTGTGGCAGTATGTGGAGGTAGG + Intronic
1116207916 14:41891904-41891926 CTGTGACAGAATCGGGAGGACGG - Exonic
1117503363 14:56376053-56376075 CTGTGAAAGAAGGGGGTGGGGGG - Intergenic
1117575779 14:57095750-57095772 CTGTGACAGTATTGGGAGGTGGG - Intergenic
1118175385 14:63434733-63434755 TCTTGAAAGAATGGGGAGGTGGG - Intronic
1119479520 14:74950867-74950889 GTGGGGAAGAATGGGGAGCTGGG + Intronic
1119705946 14:76782608-76782630 CTCTGAAGGAGTGGGGAGGTGGG + Exonic
1121006858 14:90496176-90496198 CTGTCAAAGAAGGGGCAGGTTGG + Intergenic
1122984298 14:105205229-105205251 CTGTGGAAGGCTGGGGAAGTTGG + Intergenic
1124017141 15:25886939-25886961 CTGGCACAGAATGGGGAGGTTGG - Intergenic
1126970177 15:54101882-54101904 AAGTATAAGAATGGGGAGGATGG - Intronic
1127113333 15:55698293-55698315 CTGTCTAAGAATGGAGTGGGTGG - Intronic
1128028280 15:64458141-64458163 CTGTGGAACAGTGGGGTGGTGGG + Intergenic
1128054121 15:64687260-64687282 CTGTAAAAGGCTGGGGAGGTTGG - Intergenic
1128707266 15:69845711-69845733 CTGTGTATGTGTGGGGAGGGAGG + Intergenic
1129628248 15:77229058-77229080 CTGGTTCAGAATGGGGAAGTAGG - Intronic
1130384112 15:83396353-83396375 CTGCCAAAGAAGGGGGAGGTGGG + Intergenic
1131256936 15:90869243-90869265 CTGTGTAAAACTGGTAAGGTGGG + Intronic
1133466752 16:6034822-6034844 CTGTTTCAGGATGGGGATGTGGG + Intronic
1134278743 16:12799975-12799997 CTGGATAAGAATGGGGATGCTGG - Intronic
1135804194 16:25527273-25527295 CTGTGGCAGGATTGGGAGGTGGG - Intergenic
1137496783 16:48975580-48975602 CTGTGTTAGACTGTGAAGGTGGG - Intergenic
1139526387 16:67519312-67519334 CTGTGCAAAGATGGAGAGGTAGG + Intronic
1139819295 16:69707767-69707789 CTGTGGCAGAATTGAGAGGTGGG - Intronic
1141100972 16:81197337-81197359 ATGTTTAAGCATGTGGAGGTGGG - Intergenic
1144749604 17:17639326-17639348 CTTTATAAGAATGGGGAAGCAGG + Intergenic
1144783111 17:17817588-17817610 CTGTCTATGAAATGGGAGGTAGG + Intronic
1146712465 17:35054548-35054570 CAGTTTAGGAATGGAGAGGTGGG - Intronic
1148080926 17:44967447-44967469 CTCTGCAAGAATGGCCAGGTGGG - Exonic
1148221613 17:45866455-45866477 GTTTGTAAGAATGAGGGGGTTGG - Intergenic
1148808768 17:50277692-50277714 CTGTGGAAGAAAAGAGAGGTCGG - Intronic
1149301959 17:55313535-55313557 CTGTGTAAGAATGGGGAGGTGGG + Intronic
1149429379 17:56585158-56585180 CTTTGGTAAAATGGGGAGGTAGG - Intergenic
1149613525 17:57977087-57977109 TTGTGTTAGAATGGGGAGAGGGG - Intronic
1151024293 17:70659162-70659184 CTGTGTAACTATGAGGATGTTGG + Intergenic
1151168349 17:72224164-72224186 CAATGCAAGAATGGGGTGGTGGG - Intergenic
1151867121 17:76811202-76811224 CTGTCTAAGAAGGGGGAGGTGGG + Intergenic
1153741158 18:8130070-8130092 ATGTTGCAGAATGGGGAGGTAGG - Intronic
1153818294 18:8809866-8809888 CTGGGTGTGAATGAGGAGGTGGG + Intronic
1156624928 18:38897295-38897317 CAGTGTATGAATGGCGAGGTGGG - Intergenic
1157939856 18:51916601-51916623 CTGGGTAAGAATGTGTTGGTTGG + Intergenic
1157988465 18:52466916-52466938 CTGTGTAAGCTTGGGCAAGTTGG - Intronic
1158163643 18:54514501-54514523 CTGTGTCAGAATGGGCCAGTGGG - Intergenic
1159084776 18:63776280-63776302 TGGTGAAAGAATGGGGAGGGAGG - Intronic
1160049869 18:75422791-75422813 GTCTCTAAGAATGGGGAGGAAGG + Intronic
1161899162 19:7105006-7105028 CTGGGTTAGAATGGGGATGTGGG - Intergenic
1164669945 19:30066806-30066828 CTGTGTACCCATGGGGTGGTGGG + Intergenic
1165974154 19:39659637-39659659 CAATGTAAGTATTGGGAGGTTGG - Intronic
1167950921 19:53027019-53027041 AAGTGTAAAAATGGGGAGGTTGG + Intergenic
1168727478 19:58595191-58595213 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
925899536 2:8498731-8498753 CTGTGTGAGAACAGTGAGGTGGG + Intergenic
926583817 2:14662970-14662992 CTGTGTTGGGGTGGGGAGGTGGG + Intergenic
929031502 2:37653820-37653842 ATGTATAAAAATGGGCAGGTGGG + Intronic
929325635 2:40607409-40607431 CTGTAGAAGAAGGGGCAGGTGGG - Intronic
929575590 2:43049910-43049932 GGGAGTAAGAGTGGGGAGGTAGG - Intergenic
929885271 2:45872503-45872525 CTGTGTAAGAATGGGCAGCAAGG + Intronic
930098438 2:47584869-47584891 CTGTGTAAGAGTGGGAAGAAAGG + Intergenic
931767241 2:65467578-65467600 CTGAGCAAGAATGGGAAGATTGG - Intergenic
932239569 2:70146171-70146193 ATGTGTATGGGTGGGGAGGTAGG + Intergenic
932566385 2:72913801-72913823 CTATGAAAGAATGGGGTGGAGGG + Intergenic
933559482 2:83873711-83873733 CTGAGTCAGAATGGGGTGGGGGG - Intergenic
933742744 2:85547678-85547700 CTTTGTAAGAATGGGTGGGAGGG - Exonic
934974625 2:98792112-98792134 CTTTTTAAAAATGGGGATGTTGG + Intergenic
936065674 2:109330481-109330503 CTTTGTAAGAATGGGGGGCAGGG + Intronic
936225722 2:110648634-110648656 GTGTGTATATATGGGGAGGTAGG + Intronic
936474066 2:112824385-112824407 CTCTGTAATAATGTGGGGGTGGG - Intergenic
936571074 2:113616003-113616025 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
938053497 2:128196078-128196100 CTGTGTGATGATGGGGAGGGCGG + Intergenic
938809820 2:134842880-134842902 CTGGGGAAGGATAGGGAGGTAGG - Intronic
939624648 2:144461974-144461996 ATTGGTAAAAATGGGGAGGTGGG - Intronic
940018753 2:149134626-149134648 CTGTGAGAGAATGGGGTTGTTGG - Intronic
940713686 2:157193066-157193088 TTGTGTATGAATGGGGATGTGGG - Intergenic
941304442 2:163844876-163844898 GTGTGTGCGCATGGGGAGGTGGG + Intergenic
941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG + Intronic
942094212 2:172522609-172522631 CTGTGGAAGCATGGGCAGATAGG - Intergenic
942432547 2:175928630-175928652 CTGTATAAGAATGGTGTGTTTGG - Exonic
942737353 2:179129985-179130007 TTGTTTCAGAATTGGGAGGTAGG - Intronic
942939334 2:181598182-181598204 CTGTGTAGGGATGGGGAGTTGGG - Intronic
943851566 2:192729766-192729788 CTGTGTTAGTGTGGAGAGGTGGG + Intergenic
944069221 2:195651251-195651273 CACTGTCAGAATGGGGAAGTTGG - Intronic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
948754036 2:240148927-240148949 CTGGGTGGGAGTGGGGAGGTGGG + Intergenic
948784571 2:240345679-240345701 CTGTGTCAGAATTGGGGTGTGGG + Intergenic
948935862 2:241164223-241164245 CTGGGGCAGAAGGGGGAGGTGGG - Intronic
1168854746 20:1000881-1000903 CTGTGGGAGAATTGGGAGGTGGG - Intronic
1168967627 20:1908507-1908529 CTGTGTCTGAATGGGGGGCTAGG - Intronic
1170993375 20:21326791-21326813 CTGTGAAATACTGGGGATGTTGG + Intronic
1171510000 20:25674491-25674513 CAGTGTAAGTATTAGGAGGTGGG - Exonic
1172429006 20:34875093-34875115 CTGTGAAATGATGGTGAGGTGGG + Intronic
1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG + Intergenic
1173833970 20:46113071-46113093 CGGTGTGGGAATGGGCAGGTGGG + Intergenic
1174106215 20:48164261-48164283 GTGTGAAAGAGTGGGCAGGTGGG - Intergenic
1175120874 20:56715389-56715411 CTGTGAAAGCCTGGGGAGGGAGG - Intergenic
1175272204 20:57742266-57742288 CTGTGAAGGAAAGGGGAGGTGGG + Intergenic
1175978573 20:62725806-62725828 AGGTGGAAGAAGGGGGAGGTTGG + Intronic
1176387536 21:6146253-6146275 CTGTGTGGGGATAGGGAGGTCGG - Intergenic
1176678532 21:9803913-9803935 CTTTGTACGAAGGGGTAGGTTGG - Intergenic
1177828101 21:26106433-26106455 CTGAGGAAGAATGGGGAGATAGG - Intronic
1177974187 21:27826919-27826941 GTGTTTGAGAATGGGAAGGTGGG - Intergenic
1179735936 21:43391995-43392017 CTGTGTGGGGATAGGGAGGTCGG + Intergenic
1179918946 21:44496755-44496777 CAGGGGAAGACTGGGGAGGTGGG + Intergenic
1180262919 21:46686993-46687015 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1180853434 22:19032698-19032720 CTGTGGGAGGATGGGGCGGTGGG - Intergenic
1182601574 22:31469121-31469143 CTGTGTAATGATGGGGTGGTGGG + Intronic
1183235999 22:36618185-36618207 CTTGGGAAGAAAGGGGAGGTTGG - Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
1184968475 22:47998237-47998259 CTGTGTGTGAATGGGGAGGGGGG - Intergenic
950186294 3:10947741-10947763 AAGGGTCAGAATGGGGAGGTTGG + Intergenic
951524852 3:23643967-23643989 CTGGGGAGGAATGGGGAGTTGGG + Intergenic
953033463 3:39192415-39192437 CTGTGGAAGGATGGAGAGGTAGG + Intronic
955236987 3:57148378-57148400 AAGCGTAAAAATGGGGAGGTAGG - Intronic
956163269 3:66377042-66377064 CTGAGTAGGTATGGGGAGGGGGG + Intronic
956201658 3:66712559-66712581 CTGTGTAAAAATGTGGAGCCAGG + Intergenic
956531294 3:70222131-70222153 CTGTGTAAGCCTGGGGAGACAGG - Intergenic
957079958 3:75628903-75628925 CTGTGTCAGTGTGGGGTGGTGGG + Intergenic
958849529 3:99307290-99307312 CTGTGTAAGAATTTGGAGAGAGG - Intergenic
959040618 3:101419266-101419288 GTGTCTAAGAATGGGCAGTTAGG + Intronic
960892045 3:122459434-122459456 CTTTGTAGGAAGAGGGAGGTAGG - Intronic
961865658 3:129951847-129951869 CACTGTAAGCATGGGGAAGTAGG - Intergenic
962802294 3:138900774-138900796 ATGTGTAAGGAGGGAGAGGTTGG + Intergenic
963007799 3:140742091-140742113 GTGTGTAAGAAAGGGGCGGATGG + Intergenic
964477179 3:157107670-157107692 CTGGGAAGGAATGGGGAGGGTGG - Intergenic
965191739 3:165539122-165539144 TTGTGTAAGAATGTGAAGCTTGG + Intergenic
965491818 3:169346755-169346777 GTGTGTAAGAGTGGGGAAATAGG + Intronic
965570000 3:170162890-170162912 CTTTTTAAGAATGGTGAGGAGGG - Intronic
966061624 3:175763815-175763837 GTGTGTTAGAATGGGGAGGAAGG - Intronic
967597912 3:191349555-191349577 CTGTGAAAGAATCGGAAGGATGG + Intronic
967606963 3:191458268-191458290 CTGTGAGAGAAATGGGAGGTGGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968840032 4:2996583-2996605 CTGTGACAGTATTGGGAGGTAGG - Intronic
969327437 4:6452077-6452099 CTGTGTAAGTGTGGGGAGGTTGG + Intronic
970642670 4:18084724-18084746 CTGAACAAGAATGTGGAGGTGGG + Intergenic
971152194 4:24045070-24045092 CTGTGTAAGAATTAGGATGTAGG - Intergenic
975960040 4:79891372-79891394 CTTTGTATGAATGGGGAGGTTGG + Intergenic
977216108 4:94285736-94285758 CTGTGGAAGCTTGGGGAGGTGGG + Intronic
980579357 4:134729813-134729835 CAGTGGAGGAATAGGGAGGTTGG - Intergenic
980970481 4:139562646-139562668 CTGTGCAGGAGTGGAGAGGTTGG + Intronic
982832893 4:160086122-160086144 CCGTGAAAGCATGGGGAGGGAGG - Intergenic
984925977 4:184807432-184807454 TTCTGTAAGAGTGGGGAGGAGGG - Intronic
985078312 4:186240672-186240694 CTGTGGAAGATTGGGAAGGTTGG + Intronic
985397025 4:189555056-189555078 CTTTGTACGAAGGGGTAGGTTGG + Intergenic
986012143 5:3725890-3725912 CTGTGTAAGAATTGGGGGCAAGG - Intergenic
988804175 5:34724923-34724945 CTCTGGGAGAATGGAGAGGTGGG + Intronic
989000656 5:36756940-36756962 CAGTGTAAGGAAGGGGAAGTTGG + Intergenic
991515037 5:67425804-67425826 CTGGGTGAGATTGGGGAGGATGG + Intergenic
996227562 5:121019334-121019356 CTCTGAAAGAATGAGGTGGTGGG - Intergenic
996591646 5:125154688-125154710 CTGAGTAAGAAAGGGGAGGGAGG - Intergenic
997452609 5:133995743-133995765 CTGTGTAAAAATGGGCATTTTGG - Intronic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
999347958 5:150840926-150840948 CTGTGTGGGAGTGGGGAGGGTGG + Intergenic
999894714 5:156018779-156018801 CTGTGTATGAATGCTGAAGTAGG - Intronic
1000282983 5:159798292-159798314 CTGTGTGAGAATGGGGACTGAGG + Intergenic
1001017257 5:168152843-168152865 CTGTGTATGAATGCGGATGTGGG - Intronic
1002109393 5:176898103-176898125 GTGTGTGGGAATGGGGAGGAGGG - Intronic
1002213612 5:177612501-177612523 CTGTGCAGAAGTGGGGAGGTGGG + Intergenic
1002745675 5:181469966-181469988 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1002933551 6:1651718-1651740 CTATCTAAGGATGGAGAGGTTGG - Intronic
1003006627 6:2388893-2388915 CAGTGTAGGGATGGGGAGCTGGG - Intergenic
1004440136 6:15642118-15642140 CTGTGTAGGGAAGGGGAGTTGGG - Intronic
1005252104 6:23959103-23959125 TTGTGTCAGAAAGGGGAGATGGG - Intergenic
1005383912 6:25266700-25266722 CTGAGTTGTAATGGGGAGGTGGG + Intergenic
1006335065 6:33416113-33416135 GTGTGTGTGAATGGGGAGCTGGG - Exonic
1007091512 6:39187628-39187650 CTGAGTAAGAGATGGGAGGTAGG - Intergenic
1007474279 6:42108437-42108459 CTGTGTGAGACAGGGAAGGTGGG + Intronic
1008026522 6:46642805-46642827 CTATGTCAGAATGGAGAGGTTGG - Intronic
1008260271 6:49358147-49358169 CTGATTAAGATTGGGGTGGTAGG + Intergenic
1009983912 6:70759353-70759375 CTGTGGCAGGGTGGGGAGGTTGG + Intronic
1010672999 6:78709063-78709085 CTGTCTATGAATGAGGAAGTGGG - Intergenic
1011690950 6:89868563-89868585 CTGTGGAAGACTTGGGATGTGGG + Exonic
1011832989 6:91395806-91395828 CTGTGTGTGACTGGGGAGGCAGG + Intergenic
1012802116 6:103843601-103843623 TTGTGTAAGTATAGGGAGGGTGG + Intergenic
1012956034 6:105571197-105571219 TTCTCTAAGAATGTGGAGGTGGG + Intergenic
1013700357 6:112761081-112761103 CTCACTAAGACTGGGGAGGTGGG - Intergenic
1015193810 6:130503075-130503097 CTGTGTAAGAATTTTGAGATTGG + Intergenic
1015709850 6:136127992-136128014 CTGTTTAAGAATGAGGAGTGAGG - Intronic
1016105157 6:140153054-140153076 CTGTGTGAGAATTAGGATGTTGG + Intergenic
1016403100 6:143701596-143701618 CTGTACAAAAATGGGGAGGAGGG - Intronic
1017542607 6:155418154-155418176 GTGTGTATGAATGGGGAGGGAGG - Intronic
1017635951 6:156443250-156443272 CTGTGTAGGCATAGGCAGGTAGG - Intergenic
1017817568 6:158026819-158026841 CTGTGTCAGAAGAGGCAGGTGGG + Intronic
1017941824 6:159060208-159060230 CTCTGCAGGAATGGAGAGGTTGG + Intergenic
1019600185 7:1878733-1878755 CTGAATAAGAATGGGGGGGGGGG - Intronic
1021153206 7:17177041-17177063 CTGTGTAAGAAGTGGGAATTTGG + Intergenic
1022544037 7:31168800-31168822 CTGTGGAAGAAAGAAGAGGTTGG - Intergenic
1022622707 7:32001012-32001034 GTGTGTATGTATGGGGAGGGTGG + Intronic
1024150641 7:46568425-46568447 GTGTGTTTGTATGGGGAGGTAGG + Intergenic
1026293935 7:69034848-69034870 TTGTTTAAGATAGGGGAGGTTGG + Intergenic
1026508572 7:71007816-71007838 CTGTGTATGGTTGGGCAGGTTGG + Intergenic
1028259217 7:88640438-88640460 CTGAGTAAGACTGGGGTGGCAGG - Intergenic
1029804944 7:102986287-102986309 GTGTGTGGGGATGGGGAGGTTGG + Intronic
1031623028 7:123958582-123958604 CTGTGGAAGGATGGGGTGGGAGG + Intronic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1033312938 7:140275404-140275426 ATGCGCAGGAATGGGGAGGTGGG + Intergenic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034362916 7:150516816-150516838 ATTTATATGAATGGGGAGGTTGG + Intronic
1035513970 8:215783-215805 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
1038210035 8:25509056-25509078 CTATGTAAGAAGGGGGAAATGGG - Intergenic
1042250594 8:66752582-66752604 CTGTGAAAAACTGGGGGGGTGGG + Intronic
1044091472 8:88007739-88007761 CTCAGTCAGAATGGGGAAGTAGG - Intergenic
1044247130 8:89961664-89961686 CTATGTAAAAAAGGCGAGGTCGG + Intronic
1044543944 8:93438124-93438146 CTGTGGAACAATCAGGAGGTTGG - Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1046200473 8:110921244-110921266 CTGAGAAGTAATGGGGAGGTTGG + Intergenic
1046899433 8:119508151-119508173 CTGTGTAACAAGGGGTAGGAAGG + Intergenic
1047619181 8:126588888-126588910 TTTTGTATGACTGGGGAGGTGGG - Intergenic
1048819507 8:138367825-138367847 CCGTGGAAGAAGGTGGAGGTGGG - Intronic
1050050889 9:1600337-1600359 ATCTGTAGGAATGAGGAGGTAGG - Intergenic
1050226429 9:3462496-3462518 TTGAGTAAAAATGGGGAGGGAGG - Intronic
1050607686 9:7318235-7318257 CTCTGTAAGAAAGGGCAGGCGGG - Intergenic
1052108601 9:24550389-24550411 GGATGTAAGAATGGGGAGGTAGG - Intergenic
1053507826 9:38659814-38659836 CTGTGTCAGTTTGGGGAGGAAGG + Intergenic
1055453604 9:76453276-76453298 GTGTGTAGGAATGGGTAGATGGG + Intronic
1056210830 9:84363686-84363708 CTGAGTCAGAATGGGAAGTTGGG + Intergenic
1056507358 9:87269668-87269690 CTGTGGGAGAATGGTGAGGAAGG + Intergenic
1057480684 9:95442797-95442819 CTGTGTAAGCAAGGAGTGGTGGG - Intergenic
1058245196 9:102614706-102614728 CTCTCTAAGAATGGGAAGATGGG + Intergenic
1058873283 9:109220799-109220821 GTGTGTAAGAATGTGGAAGAAGG + Intronic
1061601943 9:131676107-131676129 GTCTTTTAGAATGGGGAGGTGGG + Intronic
1062112288 9:134788707-134788729 AGGTGTATGAATGGGTAGGTGGG + Intronic
1062338722 9:136084048-136084070 CTGAGGAAGAGCGGGGAGGTAGG + Intronic
1203580147 Un_KI270745v1:36118-36140 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1203663699 Un_KI270754v1:6452-6474 CTTTGTACGAAGGGGTAGGTTGG - Intergenic
1186304493 X:8241051-8241073 ATGTGGAAGGGTGGGGAGGTTGG + Intergenic
1186436605 X:9548329-9548351 GTGAGTAAAAATGGGGTGGTGGG - Intronic
1188957765 X:36454072-36454094 TTGTGTAGGGATGGGGAGCTGGG - Intergenic
1190375450 X:49784486-49784508 ATGTGTAAGTATGGGCATGTGGG + Intergenic
1190955242 X:55186753-55186775 CTGTCTCAGAAAGGGGAGTTGGG - Intronic
1191110319 X:56799163-56799185 CTTTGTAAGAATGGACAGGCAGG + Intergenic
1192239528 X:69318424-69318446 CTGTGGAAGGAGTGGGAGGTTGG + Intergenic
1194369891 X:93059351-93059373 CTGTGCAGGGATGGGGAGTTTGG - Intergenic
1196098431 X:111823985-111824007 CTTTGGGAGGATGGGGAGGTCGG + Intronic
1197405815 X:126048119-126048141 TTTTGTAAGTTTGGGGAGGTAGG - Intergenic
1197647762 X:129036448-129036470 CTGTGAAAGAATTGGGTGGAGGG - Intergenic
1197806128 X:130400253-130400275 CTGGGTTGGAATGGGGAGGGGGG + Intergenic
1198166549 X:134063231-134063253 CTGTGGTAGAATGGGCAGATTGG - Intergenic
1200678078 Y:6175561-6175583 CTGTGCAGGGATGGGGAGTTTGG - Intergenic
1201721864 Y:17107244-17107266 CTGTGTATGAACGGGGAAATGGG + Intergenic