ID: 1149303151

View in Genome Browser
Species Human (GRCh38)
Location 17:55324135-55324157
Sequence CTGTTGTATTTGAAGACAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 348}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149303151_1149303155 9 Left 1149303151 17:55324135-55324157 CCTTTTGTCTTCAAATACAACAG 0: 1
1: 0
2: 3
3: 28
4: 348
Right 1149303155 17:55324167-55324189 GACCCATCCCTCAAAGCAGAAGG 0: 1
1: 0
2: 4
3: 10
4: 126
1149303151_1149303160 20 Left 1149303151 17:55324135-55324157 CCTTTTGTCTTCAAATACAACAG 0: 1
1: 0
2: 3
3: 28
4: 348
Right 1149303160 17:55324178-55324200 CAAAGCAGAAGGACCCTTTGAGG 0: 1
1: 0
2: 8
3: 136
4: 1178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149303151 Original CRISPR CTGTTGTATTTGAAGACAAA AGG (reversed) Exonic
900282478 1:1879936-1879958 TTGTTGTTTTTTAAGACATAGGG + Intronic
901594602 1:10374939-10374961 CTGTTATAGATGAAGACATAAGG - Exonic
903869306 1:26421358-26421380 CTGGTGTATTTGAAGGGGAATGG - Intronic
903932699 1:26872674-26872696 CTCTTTTATTTCTAGACAAAGGG - Intergenic
904622256 1:31782490-31782512 TGGCTGTATTTGAAGACAGAGGG - Intergenic
904740165 1:32668407-32668429 CATTTGTATTTGAATAGAAAAGG - Intronic
907632245 1:56094416-56094438 CTGTTTTATTTCAACATAAATGG + Intergenic
908042521 1:60129944-60129966 ATGATGTATTTTATGACAAAAGG + Intergenic
908981764 1:69967365-69967387 CTCTGGTAACTGAAGACAAAGGG + Intronic
909139112 1:71840945-71840967 GTGTTGTAGTTAAAGACCAAAGG - Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
909451560 1:75803152-75803174 CTGGTATATTTGAAGATTAAAGG + Intronic
910287911 1:85575511-85575533 GTGTTGTATTTTAACAGAAAAGG - Intronic
910619661 1:89238874-89238896 CTGTTGTCTCTGAACAGAAATGG + Intergenic
911447054 1:98009597-98009619 CAGCTGCATTTGAAGAGAAACGG - Intergenic
911450921 1:98059512-98059534 CATTTCTATTTGAAAACAAATGG + Intergenic
911678882 1:100691620-100691642 CCCTGGTAGTTGAAGACAAAGGG - Intergenic
911786718 1:101959381-101959403 CTGTTGAATTTGGAGGCATAAGG + Intronic
911949582 1:104155095-104155117 CTGTTAGTTTTGAAGACACACGG - Intergenic
912373152 1:109189099-109189121 CTGTGGGATTTGAATACAAATGG + Exonic
912911283 1:113760898-113760920 CTGTTGAGCTTCAAGACAAATGG + Intergenic
913062991 1:115225036-115225058 CTGCTGTATGTAAAGACAGAAGG + Intergenic
913108713 1:115639628-115639650 CTGTTGTTTGTGAAGACCATGGG + Intergenic
913271622 1:117099628-117099650 TTGTTGTTTTTAAAGACAAGGGG - Intronic
913493541 1:119405281-119405303 CCCTGGTAGTTGAAGACAAAGGG + Intergenic
915059490 1:153169222-153169244 CTGTTGTGTTCAAAGGCAAAAGG - Intergenic
915428925 1:155850596-155850618 CTGCTGTATTTGAAAACTGATGG - Intronic
916691814 1:167197241-167197263 CTGAGGTTTTTGAAAACAAAGGG - Intergenic
916834354 1:168527505-168527527 ATGTGGACTTTGAAGACAAATGG - Intergenic
917367284 1:174246214-174246236 CTGTTGTTTTTGAAGAGGCAGGG - Intronic
918761408 1:188414988-188415010 CTTTTGAATTTGAACACATATGG + Intergenic
919260196 1:195182573-195182595 ATGTTGTAGGTGAAGAGAAATGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922314627 1:224432942-224432964 AAATTGTATTTGAAAACAAATGG + Intronic
923968280 1:239169121-239169143 CTGTTGCATTTACAGAGAAATGG - Intergenic
924663403 1:246044119-246044141 CTGTTGAATTAGAAGAAAACTGG - Intronic
924666273 1:246075363-246075385 TTGTTGCCTGTGAAGACAAAAGG + Intronic
1062854879 10:774994-775016 CTGTTATCTTTAAAGACACAGGG - Intergenic
1063280393 10:4623120-4623142 CTTTTCTACTTGAAGACAAATGG - Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064532216 10:16322154-16322176 TTGCTGGCTTTGAAGACAAAAGG + Intergenic
1064549507 10:16484634-16484656 CTGTTGTATTTTAAAGCTAATGG + Exonic
1064969052 10:21045062-21045084 TGGATGTATTTGAAGAAAAAAGG - Intronic
1065658967 10:27985250-27985272 TTGTTGTACTAGAAGACAAGTGG - Intronic
1068191472 10:53657888-53657910 CTGATATTTTTCAAGACAAATGG - Intergenic
1070446818 10:76513270-76513292 CTTTTGTATTTTAAAACACAGGG - Intronic
1071752575 10:88497151-88497173 AAGTTGTTTTGGAAGACAAACGG + Intronic
1073348118 10:102799867-102799889 CAGTTGTATTTGTAGCCAACAGG + Intronic
1073835169 10:107432993-107433015 GTGTTGTTTTTGAAGAAGAAAGG - Intergenic
1074083205 10:110184299-110184321 CTTTTTTTTTTGAAGACTAACGG + Intergenic
1074342079 10:112641863-112641885 CGCTTGTCTTTGAACACAAATGG + Intronic
1075230262 10:120670452-120670474 CATTTGTTTTAGAAGACAAATGG - Intergenic
1075327513 10:121546210-121546232 CTGTTGTTTAAGAAGAGAAATGG + Intronic
1076542589 10:131223541-131223563 CTGTTGGTTTTGAAGTTAAAAGG - Intronic
1076828416 10:132982191-132982213 CTGATGTATTTGATGGCAATTGG + Intergenic
1076941022 10:133608795-133608817 CTGTTGAATTTGTTGATAAATGG + Intergenic
1077578287 11:3400992-3401014 GTATTCTCTTTGAAGACAAATGG + Intergenic
1078274616 11:9831372-9831394 CTGGTGTAATTGAAGGCAATTGG - Intronic
1078715929 11:13838945-13838967 CTGCTGGTTTTGAAGACACAAGG - Intergenic
1078751307 11:14166416-14166438 CTCTTGTCTCTGAAAACAAAAGG + Intronic
1078963553 11:16308866-16308888 TTGTTGTATCTGAATACAACAGG - Intronic
1079854308 11:25581575-25581597 TTTTTGTATGTGAAGAGAAATGG - Intergenic
1082672475 11:56052490-56052512 CTGCTGTCTTTGAAGATAGAAGG + Intergenic
1083315383 11:61811757-61811779 CTGTTGTATTTTAATAGAGACGG + Intronic
1083536195 11:63468822-63468844 CTCTTGTACTGCAAGACAAAGGG + Intronic
1084235276 11:67784194-67784216 GTATTCTCTTTGAAGACAAATGG + Intergenic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1085193678 11:74651836-74651858 CTGTCATATCTAAAGACAAAGGG + Intronic
1086021078 11:82230318-82230340 CAGTAGTATTAGAAGAAAAATGG + Intergenic
1086592089 11:88526758-88526780 ATCTAGTATTTGAAGAAAAATGG + Intronic
1088152389 11:106760071-106760093 ATGTTTTATTTGAAGACACTAGG - Intronic
1088206437 11:107397584-107397606 CTCTGGTAGTGGAAGACAAAGGG + Intronic
1088270939 11:108033812-108033834 CTCTTCAGTTTGAAGACAAATGG + Exonic
1088286009 11:108188818-108188840 CTGTTGTATTTGATTTTAAATGG - Intronic
1088606007 11:111532897-111532919 CTGGTGTATTTGAGAAAAAAAGG - Intronic
1089908583 11:122072028-122072050 CTGTTTTATTTGAAGAGATCAGG + Intergenic
1089917153 11:122169048-122169070 CTTCTGTATCTGAAGACAAAAGG - Intergenic
1093065203 12:14651094-14651116 CTTTTGTATTAAAAGAGAAATGG - Intronic
1094184969 12:27632072-27632094 CTGTAGTATTTCCAGATAAATGG + Intronic
1094260029 12:28484348-28484370 CTGTTGTTTTTGCTGACAGATGG - Intronic
1094394625 12:29992460-29992482 CTGCTGGCTTTGAAGACCAAGGG - Intergenic
1095279694 12:40335637-40335659 CTGTGGTCTTTGAAGACAAAAGG + Intronic
1096155822 12:49341061-49341083 CTTTTGTATGTGAGGCCAAAAGG + Intergenic
1097324774 12:58264084-58264106 CTGTTGTTTCTGAAAAGAAATGG - Intergenic
1097536852 12:60883035-60883057 CTATTTTATTTGAAGAAAACAGG + Intergenic
1099716399 12:86298714-86298736 CTGTTTTATTTCAACACAACAGG - Intronic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1101288829 12:103345090-103345112 ATGTAGTATTTGAAGCCAAAAGG - Intronic
1101651363 12:106680397-106680419 CTGTGGCATTTGAGGACTAAGGG - Intronic
1102105392 12:110317235-110317257 CTGTTGTTTTTGAATCTAAATGG - Intronic
1104402875 12:128491271-128491293 CTATTGTATTTCAAGAAAAATGG - Intronic
1105248049 13:18670409-18670431 CATTGGTATTTGAAGGCAAAAGG + Intergenic
1105675016 13:22661770-22661792 ATGTTGTCTTTCAAGAAAAAGGG + Intergenic
1107271997 13:38630687-38630709 CTGGTCTGTTTGAAGACCAATGG - Intergenic
1107334283 13:39337028-39337050 CTGGTGAATATGAAGACAACAGG - Intergenic
1107429449 13:40327005-40327027 CTGTAGAATTTGAAGTCAGATGG + Intergenic
1108817118 13:54305469-54305491 CTCTAGTAGCTGAAGACAAAGGG + Intergenic
1109723932 13:66315055-66315077 TTGCTGGCTTTGAAGACAAAGGG + Intronic
1111162886 13:84419032-84419054 CTGTTGTATTAGGCAACAAAAGG + Intergenic
1111576961 13:90167251-90167273 CTGGTGTATTTTAATCCAAAAGG - Intergenic
1111865126 13:93758723-93758745 CTATGGTGTTTGAAGAGAAAGGG - Intronic
1111988466 13:95090185-95090207 CTGTGGTAGTGGAAGACAAAGGG + Intronic
1112455984 13:99564392-99564414 CTGTTGGTTTTGAAGAGTAAAGG + Intergenic
1113291126 13:108907521-108907543 CTGTTGTGTCTGAAGTGAAACGG - Intronic
1113873089 13:113575269-113575291 CTGTTTCATTTGAATAGAAATGG + Intergenic
1115080181 14:29441189-29441211 ATCCTGTATTTAAAGACAAATGG + Intergenic
1115996942 14:39204271-39204293 CTCTGGTAGCTGAAGACAAAGGG + Intergenic
1116164816 14:41321906-41321928 CTGTGGTATTTGCACACGAATGG + Intergenic
1116328825 14:43570086-43570108 ATATTGTATTGGAAGATAAATGG - Intergenic
1116978678 14:51144001-51144023 CTGATCTATTTTAGGACAAAAGG + Intergenic
1117374393 14:55107682-55107704 CTATTCTATTTGAAGCAAAATGG + Intergenic
1117510772 14:56448714-56448736 CACTTGTAGTGGAAGACAAAGGG - Intergenic
1118165619 14:63332688-63332710 CTCTGGTAGCTGAAGACAAAGGG + Intergenic
1118960284 14:70523762-70523784 TTGATGTTTTTGAAGACAACAGG - Exonic
1121447077 14:93985768-93985790 GTGTTGTATTTGTAGAAAACAGG - Intergenic
1123104207 14:105830466-105830488 CCCTTGTAGTTGAAGACAGAGGG - Intergenic
1126380384 15:48040560-48040582 CTGTTGTCTCTAAAGACAACAGG - Intergenic
1127698493 15:61474448-61474470 CTGTTCTATTTTCAGACAAAGGG + Intergenic
1127721216 15:61701875-61701897 CTGTTCTATTTGAAGACTTTTGG - Intergenic
1128220179 15:65963578-65963600 GTCTTGTATTTGAAGAAATACGG + Intronic
1133527940 16:6624621-6624643 GTGTTTTATATGAAAACAAATGG + Intronic
1138730696 16:59191003-59191025 CTGTTCAATTTCAAGACAGAAGG + Intergenic
1140093697 16:71857407-71857429 CAGTTGTAATGGAACACAAATGG + Intronic
1140142902 16:72275679-72275701 CTGTTAAATTTGCAAACAAATGG + Intergenic
1141953499 16:87354298-87354320 CTGTTGTTTTTGTAGAGACAAGG - Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1147126435 17:38372804-38372826 CTGTTGTAATAAAAGAAAAAAGG + Intronic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1149083855 17:52690866-52690888 CTGTAGAATTTGATGACAATAGG - Intergenic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1150530397 17:65975310-65975332 CTGTTGAATTTGACTAGAAATGG + Intronic
1151506178 17:74528957-74528979 CTTTTGCATTTGCAGACACAGGG - Intronic
1152998264 18:428811-428833 CTGATGTAATTGAATCCAAAGGG - Intronic
1153444767 18:5158574-5158596 CTGTAGTGTTTGAAACCAAATGG - Intronic
1154440804 18:14388719-14388741 CATTGGTATTTGAAGGCAAAAGG - Intergenic
1154546628 18:15617886-15617908 CTCTGTTATTTGAAGACATACGG - Intergenic
1156535598 18:37861813-37861835 CTGTTGTATTTGAATACAGATGG - Intergenic
1156959889 18:43013780-43013802 ATGTTGTGTGTAAAGACAAAAGG + Intronic
1157218619 18:45807294-45807316 CCCTGGTAATTGAAGACAAAGGG + Intergenic
1157448430 18:47766457-47766479 CTGTGGTATTTGTAGAGAGATGG + Intergenic
1157916537 18:51669145-51669167 CTGTTGTATTCCAAGACACAGGG - Intergenic
1159634770 18:70791003-70791025 CTTTTTTTTGTGAAGACAAATGG - Intergenic
1159687693 18:71443862-71443884 TTGTGGTTTTTGAAGATAAAAGG - Intergenic
1162150925 19:8645139-8645161 CTGTTTTATTTTAAGAGACAGGG + Intergenic
926014758 2:9440634-9440656 CTAATGTGTTTGAAAACAAAGGG - Exonic
926582674 2:14648520-14648542 CTGTTTTAATAGAAGACAACTGG + Intronic
926962541 2:18374289-18374311 CTTTTTTAATTGAAGAGAAATGG - Intergenic
927928536 2:27029270-27029292 TTGTTGGCTTTGAAGACAGAAGG + Intergenic
929247807 2:39721638-39721660 CTCTGGTAATTGAAAACAAACGG + Intergenic
930153747 2:48084088-48084110 CTGTGCTATATGAAGAAAAAAGG + Intergenic
930365124 2:50429981-50430003 CTGTTTTATGTGAATATAAAGGG - Intronic
931669885 2:64637592-64637614 CAGTTATGTTTGAAGACAACTGG + Intronic
932059848 2:68485259-68485281 CTGATGTCATTAAAGACAAAAGG - Intronic
933940028 2:87237467-87237489 GTGTTGATTTTGAATACAAATGG - Intergenic
935424652 2:102907330-102907352 TTCTTGATTTTGAAGACAAAGGG + Intergenic
935600386 2:104916484-104916506 TTGTTGTGTTTTGAGACAAATGG - Intergenic
935866245 2:107390739-107390761 TTGTTGTAACTGAAGAAAAAGGG - Intergenic
936353112 2:111728311-111728333 GTGTTGATTTTGAATACAAATGG + Intergenic
936415576 2:112306823-112306845 CTGTTGTCTATGGAAACAAAAGG - Intronic
937367116 2:121271254-121271276 CTTTTGCTTTTTAAGACAAATGG - Intronic
937652138 2:124331081-124331103 CTGTTGTCTTTAAAGATATATGG - Intronic
940031152 2:149262838-149262860 CAGCTGTATTTGGAGATAAAAGG + Intergenic
940609778 2:155975398-155975420 CTGTTGTTTTAGAAGAAAAGAGG + Intergenic
941159194 2:162016583-162016605 GTATTATATTTTAAGACAAAAGG + Intronic
941797321 2:169613973-169613995 CTGTTGGACTTGAACAGAAATGG - Intronic
942673232 2:178399662-178399684 ATGTTGTTTTGGAAAACAAAAGG - Intergenic
942721448 2:178957697-178957719 CTGTGGTATATGCAGACAATGGG + Intronic
943081052 2:183259671-183259693 CTGTTGTATTTTAAAATAAAAGG + Intergenic
943587153 2:189754732-189754754 CTGTAGTATTCTAAAACAAAGGG + Intronic
944031758 2:195242751-195242773 CTGTTGTACTTGCAGCAAAATGG - Intergenic
944301071 2:198125534-198125556 CTCTTGTACTTGAAAAAAAATGG - Intronic
945096520 2:206224361-206224383 CTGTTTTAATTGAAAAAAAAAGG - Intergenic
945096602 2:206225572-206225594 CTGTTGCACTTGGAGATAAAGGG + Intergenic
947786630 2:232828157-232828179 TTTTTGTTTTTGAAGACATAGGG + Intronic
948714006 2:239847200-239847222 CTCTGGTAGCTGAAGACAAAGGG + Intergenic
1170739534 20:19043154-19043176 CTGTTGTATCTGAACAAATAAGG + Intergenic
1174526893 20:51179564-51179586 CTTTTGTATTTTAATACAAAAGG - Intergenic
1174526894 20:51179565-51179587 CTTTTGTATTAAAATACAAAAGG + Intergenic
1175051892 20:56163323-56163345 CTTTTATATTTGAATATAAAGGG - Intergenic
1175065558 20:56283967-56283989 ATGTTGTATATGAACACAAACGG + Intergenic
1175083785 20:56442724-56442746 CTCTTGTATTTCAAGAGAAAAGG + Intronic
1176895394 21:14372324-14372346 CCATTGTATTTGAAGATATATGG - Exonic
1176927933 21:14772703-14772725 CTGTTGTAAATGAAGACTGATGG - Intergenic
1179172445 21:38983022-38983044 CTGTTGTATTTGAATCCAGACGG - Intergenic
1181103214 22:20555284-20555306 TTGTTGTATGTGGAGAGAAAAGG + Intronic
1183004859 22:34892611-34892633 TTGTTTTTTTGGAAGACAAAAGG - Intergenic
1184025031 22:41849359-41849381 CTTTTGTATTTTTAGAGAAATGG + Intronic
1184914112 22:47556281-47556303 CTCAAGTATTTGAAGATAAAGGG - Intergenic
949187078 3:1204929-1204951 CTGTTAGATTACAAGACAAAGGG + Intronic
950950696 3:16995331-16995353 GAGTTGTATTTGCACACAAAGGG + Intronic
953036497 3:39216184-39216206 CATTTATATTTGAAGAAAAAGGG - Intergenic
953632454 3:44630648-44630670 TAGTTGTATTTGAGCACAAAGGG + Intronic
954739354 3:52735237-52735259 CTGATGTTTTTGAAGATAACTGG - Intronic
955232997 3:57115407-57115429 CTGGTGTCTTTGATGACACATGG - Intronic
955489026 3:59464007-59464029 GTGTTGTAATTCAAAACAAATGG + Intergenic
956360631 3:68443035-68443057 CTGTTATATATGACTACAAAAGG + Intronic
956497577 3:69844930-69844952 CTGTTCTATTTTAAGGAAAATGG - Intronic
956540414 3:70331956-70331978 CTACTGTATGTGCAGACAAAGGG + Intergenic
956906653 3:73772804-73772826 CTGATGTCTCTGAAGATAAAAGG + Intergenic
957599724 3:82318996-82319018 ATGTTTTATTTGAAGTCCAAAGG + Intergenic
958067358 3:88560540-88560562 CTGTTGAATTAGATGACACATGG - Intergenic
958791043 3:98651592-98651614 CTGGTGTAATTGAAGACAGCAGG - Intergenic
959027492 3:101257323-101257345 CTGGAATATTTGTAGACAAAAGG - Intronic
959905091 3:111702482-111702504 TTGTTTTGTTTTAAGACAAAGGG + Intronic
960395786 3:117135406-117135428 CTGGTGTATTTGATTCCAAAGGG + Intronic
960404920 3:117248034-117248056 CTGTGATCTTTTAAGACAAAGGG + Intergenic
960557176 3:119042685-119042707 CTCTGGTAGCTGAAGACAAAAGG + Intronic
961397575 3:126606818-126606840 CATTTGTCTTTTAAGACAAATGG + Intronic
961840140 3:129703366-129703388 TAGTTGTATTTTAAGAGAAAAGG - Intronic
961884930 3:130090727-130090749 GTATTCTCTTTGAAGACAAATGG + Intronic
962401826 3:135067268-135067290 CTCTGGTAGCTGAAGACAAAGGG - Intronic
963703213 3:148652939-148652961 TTGTTGTATTTGTACCCAAAAGG - Intergenic
964020065 3:151999269-151999291 CAGATGTATTTAAAGAAAAAGGG + Intergenic
964601234 3:158503462-158503484 CTTTGGTAGCTGAAGACAAAGGG - Intronic
965303199 3:167030195-167030217 CTGCTGCATTTGTAGTCAAAAGG - Intergenic
966573819 3:181477233-181477255 CTGTTGGCTTTGAAGACTACAGG - Intergenic
968994075 4:3934682-3934704 GTATTCTCTTTGAAGACAAATGG + Intergenic
969408590 4:7012676-7012698 CTGTTGTATTTAACAATAAAAGG + Intronic
969819859 4:9711556-9711578 GTATTCTCTTTGAAGACAAATGG - Intergenic
971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG + Intergenic
971350020 4:25847136-25847158 CTTTGGAGTTTGAAGACAAAAGG - Intronic
971496452 4:27271106-27271128 CTGTAGGAGTTGAAGACACAAGG - Intergenic
971677814 4:29656705-29656727 GTGTTGTATTGCAAGACAGAAGG + Intergenic
972384229 4:38548661-38548683 CTGTTTTATTGGAAGAGAATTGG + Intergenic
972942626 4:44215503-44215525 CAGTTGTAATTGAAAACTAAAGG + Intronic
974188470 4:58471538-58471560 GTGTTGTGTTAGAAGACAATGGG - Intergenic
974474423 4:62361473-62361495 CTGGAGTAGCTGAAGACAAAGGG - Intergenic
975064460 4:70043088-70043110 CTGTTGTTTTCGTAGATAAATGG - Intergenic
977241395 4:94574534-94574556 CTGTTTAATTTTAAGAAAAAAGG - Intronic
977455351 4:97252740-97252762 CTTTTGTTGTTGATGACAAAAGG - Intronic
977459476 4:97307555-97307577 ATGTATGATTTGAAGACAAAAGG + Intronic
979040450 4:115785321-115785343 CGATTGAATTTGAAGAGAAAAGG - Intergenic
979115078 4:116813434-116813456 CTGTGGTAAATGCAGACAAAGGG - Intergenic
979460289 4:120974649-120974671 CTGTTGCAGATGAAGACAATGGG + Intergenic
979570580 4:122219192-122219214 CTTTTGTATTTTAAGACAATAGG + Intronic
979838960 4:125413207-125413229 CTGTGGAATTTTAAGACAAGGGG + Intronic
981461129 4:145014504-145014526 CCCTGGTAGTTGAAGACAAAGGG + Intronic
983568489 4:169179223-169179245 TTGCTGGCTTTGAAGACAAAAGG + Intronic
984552982 4:181182712-181182734 TTGCTGGCTTTGAAGACAAAAGG + Intergenic
986763490 5:10901420-10901442 ATTTTGTATTTGAAAAGAAAGGG - Intergenic
987298560 5:16576260-16576282 ATCTTGTTTTTGAAGATAAATGG - Intronic
987348987 5:17004561-17004583 CTAATGTAGTTGGAGACAAAGGG - Intergenic
987746656 5:21982271-21982293 ATGTTTTAATTGAAGTCAAAAGG - Intronic
988085905 5:26475506-26475528 CTGTTTTATGAGAAGACAAAGGG - Intergenic
990093031 5:52078945-52078967 ATGTAGTAGTTGAAGTCAAAAGG - Exonic
990124972 5:52504299-52504321 CTGTTTTATCTCCAGACAAAAGG + Intergenic
990219484 5:53572224-53572246 TTGTTATCTCTGAAGACAAATGG - Intronic
990926725 5:61034146-61034168 GTGTTGTATTTCAAGAGGAATGG + Intronic
991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG + Intergenic
991696857 5:69281081-69281103 CTGCTGTGTATGAAAACAAATGG - Exonic
991766830 5:69992029-69992051 ATGTTTTAATTGAAGTCAAAAGG - Intergenic
991846062 5:70867103-70867125 ATGTTTTAATTGAAGTCAAAAGG - Intergenic
993072147 5:83178567-83178589 CTGTTGGTTTTGAAAACAAAGGG + Intronic
993502911 5:88681995-88682017 CTGTTTTATTTAAATACAATTGG + Intergenic
993701051 5:91119859-91119881 CTATTGGATTTGCAGACAGAAGG + Intronic
993838190 5:92841542-92841564 CTATTGTTTTGGAAGATAAAGGG - Intergenic
993883859 5:93394669-93394691 CTCTGGTAGTTGAAGACAAAGGG - Intergenic
994558417 5:101334153-101334175 CTGGTGAAATTGAAGAGAAAAGG + Intergenic
995719237 5:115112665-115112687 CTGTTAGATTTAAAGCCAAATGG + Intergenic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
996901698 5:128549712-128549734 CTGTTTTCTTTGAAAACACATGG + Intronic
997036342 5:130196760-130196782 CTGTTGTAATAGAAGAATAATGG - Intergenic
997105962 5:131019650-131019672 CCCTGGTAATTGAAGACAAAGGG - Intergenic
997667680 5:135644969-135644991 CTCTTGTATTTGAAGGCAAGGGG + Intergenic
997902152 5:137776889-137776911 CTGTTATAATTGCAGAGAAATGG + Intergenic
999484832 5:151985240-151985262 CCCTGGTAGTTGAAGACAAAGGG - Intergenic
999502740 5:152163150-152163172 ATATTTTATTTGCAGACAAAGGG + Intergenic
1001834277 5:174817882-174817904 CTGTTGCAGTTGAAGCCCAAAGG - Intergenic
1003391539 6:5717429-5717451 CTGTTGTTTTTGAAGAAACTGGG + Intronic
1004023509 6:11796462-11796484 CTTTTGTATTTTAATAGAAACGG - Intronic
1004268373 6:14170200-14170222 CTGTTGAAGCTAAAGACAAAGGG + Intergenic
1005963956 6:30713289-30713311 CTGTTCAAATTGAAGGCAAAAGG + Exonic
1006525184 6:34598295-34598317 CTGTTGTATCTCAGGATAAATGG - Intronic
1008757514 6:54815400-54815422 TTGCTGGATTTGAAGACATAAGG - Intergenic
1009665779 6:66677022-66677044 CTGTTATAGATGAAAACAAAGGG - Intergenic
1009961106 6:70522259-70522281 ATGATTTATTTTAAGACAAAAGG + Intronic
1010358560 6:74965544-74965566 CTCTGGTAGCTGAAGACAAAAGG - Intergenic
1010478315 6:76317526-76317548 CAGTTGTTTTTGCAAACAAATGG + Intergenic
1011532922 6:88343864-88343886 CTATTGGATTTGAAGACTAAGGG + Intergenic
1012279584 6:97312924-97312946 GTGCTGGATTTGAAGACAGAGGG + Intergenic
1012352916 6:98275697-98275719 TTGTAGTGTTTAAAGACAAAAGG + Intergenic
1012601843 6:101108291-101108313 TTGTTGTATATGAAGAAAAATGG + Intergenic
1012672742 6:102076062-102076084 CTATTATGTTTTAAGACAAATGG - Intergenic
1012987019 6:105885881-105885903 CTGTTGTGTGTGAAACCAAAGGG + Intergenic
1013110545 6:107061506-107061528 CAGTTTTATTTGAATACAACAGG + Intergenic
1013207242 6:107956342-107956364 TTGTTGTATTTCAAGTTAAAAGG - Intronic
1014005309 6:116410914-116410936 CAGTTGTATTTGAGGGCCAAAGG + Intronic
1014042286 6:116842540-116842562 TTACTGTCTTTGAAGACAAATGG - Intergenic
1014473246 6:121841573-121841595 CTGTATTGTTTGAAGACACATGG + Intergenic
1015834133 6:137401213-137401235 CTGTTTTATTTGGAGACAGTTGG - Intergenic
1015944866 6:138489590-138489612 CTTTTGTATTTGTAGAGATAGGG - Intronic
1016391881 6:143582897-143582919 CAGTTGTATTGAAAGAAAAAAGG + Intronic
1016806961 6:148221234-148221256 CTGATTTATTTGAAGAAAATAGG - Intergenic
1017274256 6:152547548-152547570 CTGTTTCATTTGCAGACACAAGG + Intronic
1017638206 6:156464463-156464485 CTTTTCTATTTGAAGGGAAAGGG + Intergenic
1017657095 6:156640329-156640351 CTGTTGTTTTAGAAAATAAATGG - Intergenic
1017685741 6:156912569-156912591 CTTTTGGGTTTGAAGACAGAGGG - Intronic
1018217703 6:161546422-161546444 GTTTGGGATTTGAAGACAAAGGG + Intronic
1019111394 6:169718659-169718681 CTGTTTTTTTTTAAGACTAAGGG - Intronic
1019376906 7:697605-697627 CAGTTGTATTTGAGGACCAGGGG + Intronic
1020019955 7:4859601-4859623 CCTTAGTATTTGAAGACAACAGG + Exonic
1020318304 7:6922742-6922764 GTATTCTCTTTGAAGACAAATGG + Intergenic
1021127928 7:16875257-16875279 CTGTGGCATTTGAAGAAAATGGG - Intronic
1021508203 7:21408090-21408112 CTGTGGGATTTGAAGAAAGAAGG + Intergenic
1021715451 7:23457891-23457913 ATGTTGTATCTGAACAAAAAAGG + Intronic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1024391739 7:48821390-48821412 CTGATGTATGAAAAGACAAAAGG + Intergenic
1024829624 7:53434998-53435020 CTCATGTATTTAAAGTCAAAGGG - Intergenic
1027445394 7:78267655-78267677 CTGATTTATGTGAAGAGAAAGGG + Intronic
1027765816 7:82340029-82340051 CTGCTGGCTTTGAAGACCAAGGG + Intronic
1028434723 7:90789231-90789253 CTGTGGTTTTTGAAAGCAAAAGG + Intronic
1028830028 7:95317639-95317661 CTTTGTTATTTGAAGACAATTGG - Intronic
1030325235 7:108211819-108211841 CTCTGGTAGCTGAAGACAAAGGG + Intronic
1030694976 7:112575100-112575122 TTGTTGACTTTGAAGACAGAAGG - Intergenic
1031222834 7:118993770-118993792 CTGTTGTATCCCAAGACAGATGG - Intergenic
1031476424 7:122228047-122228069 ATATTATATTTGAAGACTAAAGG - Intergenic
1032157604 7:129481861-129481883 CTTTTGTTTTTTAACACAAATGG - Intronic
1032163322 7:129526984-129527006 CTGTTGCTTTTAAAGACCAATGG - Intergenic
1033383604 7:140849024-140849046 CTCTGGTATTTGGAGCCAAATGG + Intronic
1034990766 7:155546791-155546813 TTGCTGGATTTGAAGTCAAAGGG + Intergenic
1035215906 7:157366574-157366596 GTTTTTTCTTTGAAGACAAAAGG + Intronic
1035699043 8:1624199-1624221 CTGTTGTATTGGAAGAAAATTGG + Intronic
1036035894 8:5018528-5018550 CTTTTGTCTTTGAAGACTCAGGG - Intergenic
1036560923 8:9899690-9899712 CGTTTCTATTTTAAGACAAAAGG + Intergenic
1037430530 8:18808376-18808398 CTCTTGTATTTGAACAAAATTGG - Intronic
1037536947 8:19833626-19833648 CTGTTGTACTTGGAAACACAAGG + Intronic
1038064151 8:23944676-23944698 CTTTTGTATATGATGAAAAATGG + Intergenic
1039416062 8:37394909-37394931 CTGATCTATTTTAAGAAAAAAGG - Intergenic
1039749377 8:40463166-40463188 CTTTTGTATTTTAATACAGACGG - Intergenic
1041113758 8:54513377-54513399 CTGTTGGCTTTGAAGAAGAAAGG + Intergenic
1041475151 8:58256812-58256834 TTGGTGTCTTTTAAGACAAAAGG + Intergenic
1041750932 8:61260349-61260371 CCGTTTTATTTGCAAACAAATGG - Intronic
1042248670 8:66733852-66733874 CTGATTTATTTGAAAACAAAGGG + Intronic
1042371894 8:68001451-68001473 CTGTTGTGGTTGCAGAGAAAAGG + Intronic
1043507150 8:80913465-80913487 CTGTTGGATTTTAAGCAAAAAGG + Intergenic
1043971039 8:86528639-86528661 GTGTTGTTTTTGAATACAAGTGG + Exonic
1045868901 8:106902902-106902924 TTGTTGGATTTGAAGACAAAAGG - Intergenic
1046024275 8:108703382-108703404 CTGTTGTATCTAAAGGCATAAGG + Intronic
1046118489 8:109814307-109814329 GTGTTGTATTTAAAGACAGATGG - Intergenic
1047128957 8:121996489-121996511 CTGTAGTATTTTAATATAAATGG + Intergenic
1047165115 8:122430037-122430059 CTGGTGAAATTGAAGAGAAAAGG + Intergenic
1047554695 8:125916452-125916474 CAGGTGTATTATAAGACAAATGG + Intergenic
1048331397 8:133473114-133473136 CTGTGTTCTTTGAAGACACATGG + Intronic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1050838006 9:10108746-10108768 ATGTGGTATTTGCACACAAAGGG + Intronic
1052449542 9:28611131-28611153 GTAATGTATTTGAAGACAAAAGG - Intronic
1054860228 9:69944464-69944486 CTGTTGTATTTAGAGAAAGAAGG + Intergenic
1055114839 9:72595206-72595228 CTGAAGGATTTGAAGCCAAATGG + Intronic
1055240139 9:74173969-74173991 CTGTTGTATTTAAGAAAAAATGG + Intergenic
1055870720 9:80876060-80876082 CTATTGTACTTGGAGAAAAAGGG - Intergenic
1056151854 9:83798686-83798708 CTGTTTTTTTTGTAGACAAAGGG + Intronic
1056987373 9:91375815-91375837 CAGTTGCATTTCAAGACAAAAGG + Intergenic
1057715548 9:97492455-97492477 GTGTGGTTTTTGAAGTCAAAAGG + Intronic
1057968845 9:99533398-99533420 TTTTTCTCTTTGAAGACAAATGG + Intergenic
1058196112 9:101978542-101978564 CTGCTGGCTTTGAAGACAGAAGG - Intergenic
1058546194 9:106062661-106062683 CTGAGGAATTTGAATACAAAGGG - Intergenic
1059866134 9:118515903-118515925 CTGTTAAAATTGAAGAGAAACGG + Intergenic
1059881426 9:118694318-118694340 TTTTTGTATTAGAAGACAAAAGG - Intergenic
1060376995 9:123124575-123124597 CTGATGTAATTGAAGAGGAAAGG + Exonic
1061742786 9:132719354-132719376 CTGTAGTTTTTGAAGAAACAGGG - Intergenic
1187672291 X:21680137-21680159 CTGAATTGTTTGAAGACAAAAGG - Intergenic
1188233136 X:27690956-27690978 CAGTGGTATTTGATGACACATGG - Intronic
1188316739 X:28683807-28683829 CTGCTGGCTTTGAAGACAGAAGG - Intronic
1191062578 X:56315324-56315346 GTGTAGTATTTGAACAAAAATGG + Intergenic
1192024972 X:67440237-67440259 CTGTTTATTTTAAAGACAAATGG + Intergenic
1193104982 X:77660983-77661005 TTGCTGTAGTTGATGACAAATGG - Intronic
1193785989 X:85760408-85760430 CCCTGGTATCTGAAGACAAAGGG - Intergenic
1193791666 X:85821935-85821957 CTCTGGTAGATGAAGACAAAAGG + Intergenic
1193946612 X:87744167-87744189 CTTTTGAATTTAAAGGCAAATGG + Intergenic
1194550204 X:95288908-95288930 CTGCTATATTTAAAAACAAATGG + Intergenic
1196041073 X:111204671-111204693 CTGTTTTATTAGAATGCAAAGGG - Intronic
1198018834 X:132638545-132638567 CTGTTGCATTTGCAGACAGTGGG + Intronic
1198616467 X:138463425-138463447 CTCTGGTAACTGAAGACAAAGGG + Intergenic
1199693905 X:150329936-150329958 CATTTCAATTTGAAGACAAAAGG - Intergenic
1200163707 X:154021944-154021966 CTGATATATTTAAAAACAAAAGG - Intronic
1200212531 X:154353147-154353169 CTGGTGCATGTGAAGAAAAATGG - Exonic
1200826070 Y:7642865-7642887 CTGTTGGATGTGAAGAGAAGAGG - Intergenic
1201507974 Y:14725280-14725302 CTATATTATTTGAATACAAAGGG - Intronic
1201512710 Y:14782824-14782846 GTGTTGGATTTGAGGCCAAATGG + Intronic
1201633451 Y:16095708-16095730 CTGTAGTGTGAGAAGACAAAGGG + Intergenic