ID: 1149304766

View in Genome Browser
Species Human (GRCh38)
Location 17:55336842-55336864
Sequence AAGGATCTATGTGGTAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304766_1149304777 21 Left 1149304766 17:55336842-55336864 CCTGCCTTACCACATAGATCCTT No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304766_1149304776 20 Left 1149304766 17:55336842-55336864 CCTGCCTTACCACATAGATCCTT No data
Right 1149304776 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
1149304766_1149304774 8 Left 1149304766 17:55336842-55336864 CCTGCCTTACCACATAGATCCTT No data
Right 1149304774 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304766 Original CRISPR AAGGATCTATGTGGTAAGGC AGG (reversed) Intergenic