ID: 1149304767

View in Genome Browser
Species Human (GRCh38)
Location 17:55336846-55336868
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304767_1149304774 4 Left 1149304767 17:55336846-55336868 CCTTACCACATAGATCCTTCCCC No data
Right 1149304774 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
1149304767_1149304776 16 Left 1149304767 17:55336846-55336868 CCTTACCACATAGATCCTTCCCC No data
Right 1149304776 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
1149304767_1149304780 29 Left 1149304767 17:55336846-55336868 CCTTACCACATAGATCCTTCCCC No data
Right 1149304780 17:55336898-55336920 GCATCCAAGGGCTGAGCAGCAGG No data
1149304767_1149304781 30 Left 1149304767 17:55336846-55336868 CCTTACCACATAGATCCTTCCCC No data
Right 1149304781 17:55336899-55336921 CATCCAAGGGCTGAGCAGCAGGG No data
1149304767_1149304777 17 Left 1149304767 17:55336846-55336868 CCTTACCACATAGATCCTTCCCC No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304767 Original CRISPR GGGGAAGGATCTATGTGGTA AGG (reversed) Intergenic