ID: 1149304768

View in Genome Browser
Species Human (GRCh38)
Location 17:55336851-55336873
Sequence GTTTAGGGGAAGGATCTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304768_1149304777 12 Left 1149304768 17:55336851-55336873 CCACATAGATCCTTCCCCTAAAC No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304768_1149304774 -1 Left 1149304768 17:55336851-55336873 CCACATAGATCCTTCCCCTAAAC No data
Right 1149304774 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
1149304768_1149304784 29 Left 1149304768 17:55336851-55336873 CCACATAGATCCTTCCCCTAAAC No data
Right 1149304784 17:55336903-55336925 CAAGGGCTGAGCAGCAGGGTGGG No data
1149304768_1149304776 11 Left 1149304768 17:55336851-55336873 CCACATAGATCCTTCCCCTAAAC No data
Right 1149304776 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
1149304768_1149304781 25 Left 1149304768 17:55336851-55336873 CCACATAGATCCTTCCCCTAAAC No data
Right 1149304781 17:55336899-55336921 CATCCAAGGGCTGAGCAGCAGGG No data
1149304768_1149304780 24 Left 1149304768 17:55336851-55336873 CCACATAGATCCTTCCCCTAAAC No data
Right 1149304780 17:55336898-55336920 GCATCCAAGGGCTGAGCAGCAGG No data
1149304768_1149304783 28 Left 1149304768 17:55336851-55336873 CCACATAGATCCTTCCCCTAAAC No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304768 Original CRISPR GTTTAGGGGAAGGATCTATG TGG (reversed) Intergenic