ID: 1149304770

View in Genome Browser
Species Human (GRCh38)
Location 17:55336865-55336887
Sequence AGGAATGCTTCATGGTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304770_1149304777 -2 Left 1149304770 17:55336865-55336887 CCCCTAAACCATGAAGCATTCCT No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304770_1149304784 15 Left 1149304770 17:55336865-55336887 CCCCTAAACCATGAAGCATTCCT No data
Right 1149304784 17:55336903-55336925 CAAGGGCTGAGCAGCAGGGTGGG No data
1149304770_1149304783 14 Left 1149304770 17:55336865-55336887 CCCCTAAACCATGAAGCATTCCT No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304770_1149304776 -3 Left 1149304770 17:55336865-55336887 CCCCTAAACCATGAAGCATTCCT No data
Right 1149304776 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
1149304770_1149304780 10 Left 1149304770 17:55336865-55336887 CCCCTAAACCATGAAGCATTCCT No data
Right 1149304780 17:55336898-55336920 GCATCCAAGGGCTGAGCAGCAGG No data
1149304770_1149304781 11 Left 1149304770 17:55336865-55336887 CCCCTAAACCATGAAGCATTCCT No data
Right 1149304781 17:55336899-55336921 CATCCAAGGGCTGAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304770 Original CRISPR AGGAATGCTTCATGGTTTAG GGG (reversed) Intergenic