ID: 1149304771

View in Genome Browser
Species Human (GRCh38)
Location 17:55336866-55336888
Sequence GAGGAATGCTTCATGGTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304771_1149304784 14 Left 1149304771 17:55336866-55336888 CCCTAAACCATGAAGCATTCCTC No data
Right 1149304784 17:55336903-55336925 CAAGGGCTGAGCAGCAGGGTGGG No data
1149304771_1149304780 9 Left 1149304771 17:55336866-55336888 CCCTAAACCATGAAGCATTCCTC No data
Right 1149304780 17:55336898-55336920 GCATCCAAGGGCTGAGCAGCAGG No data
1149304771_1149304783 13 Left 1149304771 17:55336866-55336888 CCCTAAACCATGAAGCATTCCTC No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304771_1149304776 -4 Left 1149304771 17:55336866-55336888 CCCTAAACCATGAAGCATTCCTC No data
Right 1149304776 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
1149304771_1149304781 10 Left 1149304771 17:55336866-55336888 CCCTAAACCATGAAGCATTCCTC No data
Right 1149304781 17:55336899-55336921 CATCCAAGGGCTGAGCAGCAGGG No data
1149304771_1149304777 -3 Left 1149304771 17:55336866-55336888 CCCTAAACCATGAAGCATTCCTC No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304771 Original CRISPR GAGGAATGCTTCATGGTTTA GGG (reversed) Intergenic