ID: 1149304773

View in Genome Browser
Species Human (GRCh38)
Location 17:55336873-55336895
Sequence CCTGGAGGAGGAATGCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304773_1149304781 3 Left 1149304773 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
Right 1149304781 17:55336899-55336921 CATCCAAGGGCTGAGCAGCAGGG No data
1149304773_1149304785 24 Left 1149304773 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
Right 1149304785 17:55336920-55336942 GGTGGGTTAGCCCATAGTGTAGG No data
1149304773_1149304783 6 Left 1149304773 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304773_1149304780 2 Left 1149304773 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
Right 1149304780 17:55336898-55336920 GCATCCAAGGGCTGAGCAGCAGG No data
1149304773_1149304777 -10 Left 1149304773 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304773_1149304784 7 Left 1149304773 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
Right 1149304784 17:55336903-55336925 CAAGGGCTGAGCAGCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304773 Original CRISPR CCTGGAGGAGGAATGCTTCA TGG (reversed) Intergenic