ID: 1149304774

View in Genome Browser
Species Human (GRCh38)
Location 17:55336873-55336895
Sequence CCATGAAGCATTCCTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304768_1149304774 -1 Left 1149304768 17:55336851-55336873 CCACATAGATCCTTCCCCTAAAC No data
Right 1149304774 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
1149304766_1149304774 8 Left 1149304766 17:55336842-55336864 CCTGCCTTACCACATAGATCCTT No data
Right 1149304774 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
1149304767_1149304774 4 Left 1149304767 17:55336846-55336868 CCTTACCACATAGATCCTTCCCC No data
Right 1149304774 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304774 Original CRISPR CCATGAAGCATTCCTCCTCC AGG Intergenic