ID: 1149304775

View in Genome Browser
Species Human (GRCh38)
Location 17:55336885-55336907
Sequence CCTTGGATGCTTCCTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304775_1149304781 -9 Left 1149304775 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
Right 1149304781 17:55336899-55336921 CATCCAAGGGCTGAGCAGCAGGG No data
1149304775_1149304784 -5 Left 1149304775 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
Right 1149304784 17:55336903-55336925 CAAGGGCTGAGCAGCAGGGTGGG No data
1149304775_1149304785 12 Left 1149304775 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
Right 1149304785 17:55336920-55336942 GGTGGGTTAGCCCATAGTGTAGG No data
1149304775_1149304780 -10 Left 1149304775 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
Right 1149304780 17:55336898-55336920 GCATCCAAGGGCTGAGCAGCAGG No data
1149304775_1149304783 -6 Left 1149304775 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304775_1149304786 21 Left 1149304775 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
Right 1149304786 17:55336929-55336951 GCCCATAGTGTAGGCAGTTCAGG No data
1149304775_1149304788 22 Left 1149304775 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
Right 1149304788 17:55336930-55336952 CCCATAGTGTAGGCAGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304775 Original CRISPR CCTTGGATGCTTCCTGGAGG AGG (reversed) Intergenic