ID: 1149304777

View in Genome Browser
Species Human (GRCh38)
Location 17:55336886-55336908
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304769_1149304777 2 Left 1149304769 17:55336861-55336883 CCTTCCCCTAAACCATGAAGCAT No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304771_1149304777 -3 Left 1149304771 17:55336866-55336888 CCCTAAACCATGAAGCATTCCTC No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304768_1149304777 12 Left 1149304768 17:55336851-55336873 CCACATAGATCCTTCCCCTAAAC No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304772_1149304777 -4 Left 1149304772 17:55336867-55336889 CCTAAACCATGAAGCATTCCTCC No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304766_1149304777 21 Left 1149304766 17:55336842-55336864 CCTGCCTTACCACATAGATCCTT No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304770_1149304777 -2 Left 1149304770 17:55336865-55336887 CCCCTAAACCATGAAGCATTCCT No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304773_1149304777 -10 Left 1149304773 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data
1149304767_1149304777 17 Left 1149304767 17:55336846-55336868 CCTTACCACATAGATCCTTCCCC No data
Right 1149304777 17:55336886-55336908 CTCCTCCAGGAAGCATCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304777 Original CRISPR CTCCTCCAGGAAGCATCCAA GGG Intergenic