ID: 1149304778

View in Genome Browser
Species Human (GRCh38)
Location 17:55336888-55336910
Sequence AGCCCTTGGATGCTTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304778_1149304788 19 Left 1149304778 17:55336888-55336910 CCTCCAGGAAGCATCCAAGGGCT No data
Right 1149304788 17:55336930-55336952 CCCATAGTGTAGGCAGTTCAGGG No data
1149304778_1149304783 -9 Left 1149304778 17:55336888-55336910 CCTCCAGGAAGCATCCAAGGGCT No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304778_1149304785 9 Left 1149304778 17:55336888-55336910 CCTCCAGGAAGCATCCAAGGGCT No data
Right 1149304785 17:55336920-55336942 GGTGGGTTAGCCCATAGTGTAGG No data
1149304778_1149304786 18 Left 1149304778 17:55336888-55336910 CCTCCAGGAAGCATCCAAGGGCT No data
Right 1149304786 17:55336929-55336951 GCCCATAGTGTAGGCAGTTCAGG No data
1149304778_1149304784 -8 Left 1149304778 17:55336888-55336910 CCTCCAGGAAGCATCCAAGGGCT No data
Right 1149304784 17:55336903-55336925 CAAGGGCTGAGCAGCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304778 Original CRISPR AGCCCTTGGATGCTTCCTGG AGG (reversed) Intergenic