ID: 1149304779

View in Genome Browser
Species Human (GRCh38)
Location 17:55336891-55336913
Sequence CTCAGCCCTTGGATGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304779_1149304785 6 Left 1149304779 17:55336891-55336913 CCAGGAAGCATCCAAGGGCTGAG No data
Right 1149304785 17:55336920-55336942 GGTGGGTTAGCCCATAGTGTAGG No data
1149304779_1149304786 15 Left 1149304779 17:55336891-55336913 CCAGGAAGCATCCAAGGGCTGAG No data
Right 1149304786 17:55336929-55336951 GCCCATAGTGTAGGCAGTTCAGG No data
1149304779_1149304788 16 Left 1149304779 17:55336891-55336913 CCAGGAAGCATCCAAGGGCTGAG No data
Right 1149304788 17:55336930-55336952 CCCATAGTGTAGGCAGTTCAGGG No data
1149304779_1149304790 28 Left 1149304779 17:55336891-55336913 CCAGGAAGCATCCAAGGGCTGAG No data
Right 1149304790 17:55336942-55336964 GCAGTTCAGGGTACCTCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304779 Original CRISPR CTCAGCCCTTGGATGCTTCC TGG (reversed) Intergenic