ID: 1149304783

View in Genome Browser
Species Human (GRCh38)
Location 17:55336902-55336924
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304772_1149304783 12 Left 1149304772 17:55336867-55336889 CCTAAACCATGAAGCATTCCTCC No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304778_1149304783 -9 Left 1149304778 17:55336888-55336910 CCTCCAGGAAGCATCCAAGGGCT No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304768_1149304783 28 Left 1149304768 17:55336851-55336873 CCACATAGATCCTTCCCCTAAAC No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304771_1149304783 13 Left 1149304771 17:55336866-55336888 CCCTAAACCATGAAGCATTCCTC No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304773_1149304783 6 Left 1149304773 17:55336873-55336895 CCATGAAGCATTCCTCCTCCAGG No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304769_1149304783 18 Left 1149304769 17:55336861-55336883 CCTTCCCCTAAACCATGAAGCAT No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304775_1149304783 -6 Left 1149304775 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
1149304770_1149304783 14 Left 1149304770 17:55336865-55336887 CCCCTAAACCATGAAGCATTCCT No data
Right 1149304783 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304783 Original CRISPR CCAAGGGCTGAGCAGCAGGG TGG Intergenic