ID: 1149304786

View in Genome Browser
Species Human (GRCh38)
Location 17:55336929-55336951
Sequence GCCCATAGTGTAGGCAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149304782_1149304786 4 Left 1149304782 17:55336902-55336924 CCAAGGGCTGAGCAGCAGGGTGG No data
Right 1149304786 17:55336929-55336951 GCCCATAGTGTAGGCAGTTCAGG No data
1149304779_1149304786 15 Left 1149304779 17:55336891-55336913 CCAGGAAGCATCCAAGGGCTGAG No data
Right 1149304786 17:55336929-55336951 GCCCATAGTGTAGGCAGTTCAGG No data
1149304778_1149304786 18 Left 1149304778 17:55336888-55336910 CCTCCAGGAAGCATCCAAGGGCT No data
Right 1149304786 17:55336929-55336951 GCCCATAGTGTAGGCAGTTCAGG No data
1149304775_1149304786 21 Left 1149304775 17:55336885-55336907 CCTCCTCCAGGAAGCATCCAAGG No data
Right 1149304786 17:55336929-55336951 GCCCATAGTGTAGGCAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149304786 Original CRISPR GCCCATAGTGTAGGCAGTTC AGG Intergenic