ID: 1149308828

View in Genome Browser
Species Human (GRCh38)
Location 17:55374487-55374509
Sequence GAAAATGGACTAATACAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149308825_1149308828 7 Left 1149308825 17:55374457-55374479 CCAGTCTCAGGCATTTCTTTATA 0: 114
1: 2032
2: 5562
3: 10726
4: 12284
Right 1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG No data
1149308824_1149308828 8 Left 1149308824 17:55374456-55374478 CCCAGTCTCAGGCATTTCTTTAT 0: 126
1: 2082
2: 8416
3: 11892
4: 13499
Right 1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG No data
1149308822_1149308828 29 Left 1149308822 17:55374435-55374457 CCTCTTTTTCTGTATAAATGACC No data
Right 1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149308828 Original CRISPR GAAAATGGACTAATACAGCT GGG Intergenic
No off target data available for this crispr