ID: 1149309373

View in Genome Browser
Species Human (GRCh38)
Location 17:55379099-55379121
Sequence GTGAAAAATACGATGGCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149309366_1149309373 30 Left 1149309366 17:55379046-55379068 CCTTGAAGGAAGGAGGAAAGGGG No data
Right 1149309373 17:55379099-55379121 GTGAAAAATACGATGGCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149309373 Original CRISPR GTGAAAAATACGATGGCGTG AGG Intergenic
No off target data available for this crispr