ID: 1149309535

View in Genome Browser
Species Human (GRCh38)
Location 17:55380635-55380657
Sequence GCGGCAGCCCAGATAGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149309535 Original CRISPR GCGGCAGCCCAGATAGATGT TGG Intergenic
No off target data available for this crispr