ID: 1149311864

View in Genome Browser
Species Human (GRCh38)
Location 17:55402234-55402256
Sequence AGTGAAATTCTGAAGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 438}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149311860_1149311864 20 Left 1149311860 17:55402191-55402213 CCTAGAGTGTCTGCTTTCATTAC 0: 1
1: 0
2: 0
3: 14
4: 209
Right 1149311864 17:55402234-55402256 AGTGAAATTCTGAAGATGAATGG 0: 1
1: 0
2: 2
3: 37
4: 438
1149311862_1149311864 -7 Left 1149311862 17:55402218-55402240 CCAATCCAGAGCTAGAAGTGAAA 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1149311864 17:55402234-55402256 AGTGAAATTCTGAAGATGAATGG 0: 1
1: 0
2: 2
3: 37
4: 438
1149311861_1149311864 -2 Left 1149311861 17:55402213-55402235 CCATTCCAATCCAGAGCTAGAAG 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1149311864 17:55402234-55402256 AGTGAAATTCTGAAGATGAATGG 0: 1
1: 0
2: 2
3: 37
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149311864 Original CRISPR AGTGAAATTCTGAAGATGAA TGG Intronic
901352101 1:8606577-8606599 ATTGACATTCTTAAGATGGAAGG - Intronic
901569101 1:10144864-10144886 AGTGAAATGAGCAAGATGAATGG + Intronic
902147546 1:14416093-14416115 AGTGAAATTCCGAGGAGCAATGG + Intergenic
903871667 1:26439834-26439856 GGTGAAATTTTTAAGAAGAATGG + Intronic
904538402 1:31216342-31216364 AGTGTCATTCTGGGGATGAAAGG - Intronic
907027744 1:51138379-51138401 AAACAAATTCTGAAGATGAATGG - Intronic
907981219 1:59483228-59483250 AGGAAAATTCTCAACATGAATGG + Intronic
908369933 1:63471572-63471594 ATTGGAAGTCTGAATATGAAAGG - Intronic
909830346 1:80181432-80181454 ATTGAAAATCAGAAGGTGAAGGG - Intergenic
910162665 1:84291011-84291033 AGGGAAATTCTAAAGAGAAAAGG - Intergenic
910302328 1:85720377-85720399 AGGGAAATTCTTCAGATGAAGGG + Intergenic
910344507 1:86220381-86220403 AGGGAGATTATGAAGATGATAGG + Intergenic
911201272 1:95046744-95046766 AGTGAAAAACTGAAAATGATAGG + Intronic
911229476 1:95345657-95345679 AAAGAAACTCAGAAGATGAATGG - Intergenic
911387285 1:97193216-97193238 AGTGAAATCCTGATTCTGAATGG + Exonic
911421899 1:97653267-97653289 ACTGAAATTCTGACTATGAAAGG - Intronic
911637756 1:100254419-100254441 AGGGATATTTTGAAGATCAAAGG + Intergenic
911774516 1:101791274-101791296 AGTGCAATTCAGTAGATGAATGG + Intergenic
911852162 1:102833772-102833794 AGTGAAACTGACAAGATGAACGG + Intergenic
913291080 1:117272596-117272618 AGATAAATTCTGAAAATTAAAGG - Intergenic
913354827 1:117908192-117908214 TGAGAAATTCTTAAAATGAAGGG - Intronic
913988995 1:143592157-143592179 GCTGAAATTCCGAAGATGGAAGG - Intergenic
915834831 1:159168353-159168375 AGTGAAAATCTGAGGAAGCAGGG - Intergenic
915971984 1:160361638-160361660 AGAGAAGTTCAGAGGATGAAAGG + Intergenic
916872629 1:168933367-168933389 AGTGTATTTCTGTAGATGCATGG - Intergenic
917074212 1:171186929-171186951 AGTGCTATTTTGAAGATTAAGGG + Intronic
918150180 1:181791516-181791538 AGTGAAAGCCTGAAGAAGAGAGG + Intronic
918180085 1:182079900-182079922 TGTGATATTCTGGAGATCAAGGG + Intergenic
918557433 1:185819654-185819676 AGTAAAATATTGAAGAAGAAAGG - Intronic
920888186 1:209954415-209954437 ATTAAAATTCTGTAGATAAACGG - Intronic
921396874 1:214677859-214677881 AGTGGAGTTCTGCTGATGAAGGG - Intergenic
921771954 1:219050709-219050731 AGTGAAATACAGAAGACCAAGGG + Intergenic
922266200 1:223986278-223986300 AGTGAAATTCCTAAGATCCAGGG + Intergenic
922303036 1:224320159-224320181 AGGCAAACTCTGAATATGAATGG + Intronic
922392895 1:225165297-225165319 AGTGATATTATGAACATTAAAGG - Intronic
923048736 1:230375043-230375065 AGGGAAATTCCAAAGAAGAAAGG - Intronic
923412762 1:233726102-233726124 AGTTACAGACTGAAGATGAATGG + Intergenic
923693048 1:236215340-236215362 AGTGCTATTGTGAAGATTAACGG + Intronic
923720571 1:236463662-236463684 AGAGAAGTTCTGGAGGTGAATGG - Intronic
924043976 1:240009705-240009727 AGTGAAATTCTGTACATCTATGG - Intergenic
924222780 1:241895337-241895359 TGGAAAATTCTGAAGATGGATGG + Intergenic
924615792 1:245610643-245610665 AATGAAGTTCTAAAAATGAATGG - Intronic
1063422860 10:5927435-5927457 AGTCATTTTCTGAGGATGAATGG + Exonic
1063665210 10:8056516-8056538 AATGGAATTCTGATGCTGAAGGG + Intronic
1063693013 10:8305050-8305072 AGTGGAATTCAGACGTTGAAGGG + Intergenic
1064511293 10:16095560-16095582 AGTACAATTTTGAATATGAATGG - Intergenic
1065472210 10:26094086-26094108 ATTGAAATACTTAATATGAAAGG - Intronic
1065475175 10:26128915-26128937 ACTGGAATTCTGAAGTTTAATGG - Intronic
1066544801 10:36488314-36488336 AAAAAAATTCTGAAGATGAATGG - Intergenic
1067817459 10:49492671-49492693 TGCGAAATTCTCAAGATGGAAGG + Intronic
1068682106 10:59831187-59831209 ATTTAAATTTGGAAGATGAATGG + Intronic
1069037732 10:63663143-63663165 AGTGAGATTCTGAGCATGGAAGG - Intergenic
1070344179 10:75525375-75525397 AATGAAATTCTGAAGCAGATTGG + Intronic
1070376394 10:75835426-75835448 GTTAAAATTCTGGAGATGAAAGG - Intronic
1070470396 10:76773605-76773627 GGAAAAATTCTGAAGATAAATGG - Intergenic
1072385733 10:94925597-94925619 AGAGAAAATCAGAAGAAGAAGGG + Intergenic
1072484638 10:95843579-95843601 AGTGGGATTCTGAAAAGGAAGGG + Intronic
1073769016 10:106714981-106715003 AGTGAAATTTGCAAGCTGAAGGG + Intronic
1073846712 10:107564698-107564720 AGGGAAATTCTGCAGAACAAAGG + Intergenic
1074481622 10:113827041-113827063 AGAGAAATTCTGAAAAGGAAGGG - Intergenic
1074734382 10:116413538-116413560 AGTGAAATAATGATGATGGAAGG + Intergenic
1077611405 11:3645233-3645255 GGTGAAATTTGGGAGATGAACGG + Intronic
1077750141 11:4958188-4958210 ATTGAAATGCAGAAGAGGAAGGG - Intronic
1078719956 11:13875309-13875331 AATGTACTTCTGAAGATGAAAGG + Intergenic
1080090279 11:28340058-28340080 ACTGAAATTATGAAGCTGAAGGG + Intergenic
1080389758 11:31834181-31834203 ATTGAAATTCTGAAGAATTAGGG + Intronic
1080938779 11:36890634-36890656 AGAGAAATAATGAAGAGGAAAGG - Intergenic
1080988739 11:37504560-37504582 AGTGTAATTGTTAAGATGATAGG + Intergenic
1081885846 11:46495548-46495570 CCTGAAATTGTGCAGATGAAAGG + Intronic
1082035725 11:47643856-47643878 AGTGAAATTATGCATAGGAAAGG + Intergenic
1085936416 11:81151305-81151327 GATGAAATTCAGAAGATGGATGG + Intergenic
1086169021 11:83814712-83814734 TATGAAATTATGAAAATGAAAGG - Intronic
1086935077 11:92736460-92736482 AGTGAAATTGAGTAGAAGAATGG + Intronic
1086947428 11:92856991-92857013 AGTGAAATTTGGCAGATGTAGGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087073793 11:94109379-94109401 AGTGCAATTTTGAATATGAGTGG + Intronic
1087526514 11:99320600-99320622 AGTGAAATATTGAGAATGAAAGG + Intronic
1087635057 11:100692885-100692907 AGTGAAACACAGAAAATGAAAGG - Intronic
1088006061 11:104942051-104942073 AGAGGAATTCTGAAGGTAAATGG - Intergenic
1088068815 11:105755885-105755907 ACTGAAATTCAGAGGATGGATGG - Intronic
1088454359 11:110017949-110017971 GGTGAAGTTTTGATGATGAAAGG + Intergenic
1089123372 11:116158499-116158521 AGGGAAAGAGTGAAGATGAAGGG + Intergenic
1089879359 11:121758738-121758760 GGTGAAATTCTGACTATGATGGG - Intergenic
1090524687 11:127520590-127520612 ATGGAAATTCTGCAGTTGAAAGG - Intergenic
1090607696 11:128439080-128439102 AGTAAAAGTCAGAGGATGAAGGG + Intergenic
1091493178 12:950083-950105 TGGGAAAATCTGAGGATGAATGG + Intronic
1092633505 12:10413287-10413309 AAAGAAATTATCAAGATGAATGG + Intronic
1093256336 12:16872804-16872826 ACTGAAATTCTAAACATTAAGGG - Intergenic
1093968088 12:25347975-25347997 AGTGAAATTATATACATGAAAGG - Intergenic
1094418161 12:30239624-30239646 ACTGAAATGGTGGAGATGAATGG - Intergenic
1095280195 12:40342254-40342276 AGTCAGATACTGAAAATGAAAGG - Intronic
1097572315 12:61349471-61349493 ATTAAAATTTTGAAGATGCAAGG + Intergenic
1097599925 12:61678331-61678353 AGGGAAATAGTGAAAATGAATGG - Intergenic
1097619389 12:61922225-61922247 AGTAAATAACTGAAGATGAAAGG + Intronic
1098226010 12:68325495-68325517 TGAGAAATTCTGAATATCAAAGG - Exonic
1098550644 12:71757414-71757436 AGTGTAATTTTTAAGTTGAAAGG - Intronic
1098690783 12:73485060-73485082 AGGTATATTCTGAAGATCAAGGG - Intergenic
1099415818 12:82384930-82384952 AGTGAAATTCTCAGGTTTAAGGG - Intronic
1100078635 12:90821599-90821621 TGTGAAATCCTAAAGATGACGGG + Intergenic
1100679746 12:96906817-96906839 AGTGAAACTATGATAATGAAAGG - Intergenic
1102673696 12:114641743-114641765 AGTGCTGTTGTGAAGATGAAAGG - Intergenic
1103099702 12:118162692-118162714 ACTGTAATGCAGAAGATGAAAGG - Intronic
1103136733 12:118513948-118513970 AGTGCAAGTCTGGAGATGAGAGG + Intergenic
1103871680 12:124096787-124096809 AGTGAGATTCTGAACAAGAGAGG - Intronic
1104535152 12:129611795-129611817 AGGGAAAGTCTGGAGATGTAGGG + Intronic
1105058049 12:133121832-133121854 TGAGAAATGCTGAAGAGGAAAGG - Exonic
1105702479 13:22943767-22943789 GGTGAAATTTGGAAGATGAGGGG + Intergenic
1106425237 13:29622498-29622520 AAAGAAGTTCTGGAGATGAATGG + Intergenic
1106532473 13:30606277-30606299 ATTGATTTTCTGAAAATGAAAGG - Intronic
1110241732 13:73274932-73274954 CTTGAATTACTGAAGATGAAAGG + Intergenic
1110902704 13:80843479-80843501 ATTGGCATTATGAAGATGAAAGG + Intergenic
1111092070 13:83461416-83461438 AGTAAAATTTTGAGGCTGAAAGG - Intergenic
1111150176 13:84242888-84242910 AGTGAAATTCTGAAGCAGAAAGG + Intergenic
1111797441 13:92940775-92940797 AGGGAAATTCTGAAGAGTAATGG - Intergenic
1112149806 13:96745888-96745910 TGGGAAAGCCTGAAGATGAAAGG - Intronic
1112404571 13:99107762-99107784 AGTGAGAGTCTGAAGAAGGAAGG + Intergenic
1112496133 13:99906379-99906401 AGTGAAAATCAGAATTTGAATGG + Intergenic
1112632287 13:101175416-101175438 TGGGAAATTCTGAATATGGAGGG + Intronic
1113684114 13:112268687-112268709 AGTGAAAATATGCAGAAGAATGG - Intergenic
1113863808 13:113508435-113508457 CGTGATATTCGGAAGAGGAAGGG + Intronic
1114298836 14:21355570-21355592 AGTGAAAGGTTGAAGAAGAAAGG - Intronic
1114721272 14:24884910-24884932 TTTAAAGTTCTGAAGATGAAAGG + Intronic
1114812847 14:25920637-25920659 AGTGAAATGGTGAAGACTAAAGG + Intergenic
1117732895 14:58741534-58741556 TGTTAAATTCAGGAGATGAAGGG + Intergenic
1118395904 14:65336307-65336329 AGTCAAAATCTGAAGAAGGAGGG + Intergenic
1118879242 14:69811941-69811963 ACTGAAATTGAGAAGGTGAACGG + Intergenic
1119076853 14:71648755-71648777 TTTGCAATTCTGAAGTTGAAAGG - Intronic
1119800667 14:77442209-77442231 AGGGTTATTATGAAGATGAAGGG - Intronic
1120565500 14:86050403-86050425 AAAGAAATACTGAAGATCAAAGG + Intergenic
1121830866 14:97051001-97051023 AGTGAAATTCTGAAAATCCCAGG + Intergenic
1122639250 14:103147782-103147804 AAAGGAATTCTGAAGATGGATGG + Intergenic
1124686093 15:31783135-31783157 AGTGGCATTCTGGAGATCAAGGG + Intronic
1126760515 15:51965813-51965835 TGCAAAATTCTGATGATGAAAGG - Exonic
1126760519 15:51965915-51965937 AGGCTAATTCTGATGATGAACGG - Exonic
1128033433 15:64501803-64501825 AGTGATAGTCTGTGGATGAAAGG + Intronic
1128193643 15:65728839-65728861 ATTGAAAGCCTGAGGATGAAAGG + Intronic
1130005278 15:80090460-80090482 AGGGATATTGTGAAGATGAAAGG + Intronic
1131817997 15:96242744-96242766 AGTGAAATACTGTAAATTAAGGG - Intergenic
1132141426 15:99399954-99399976 AGTGAGCAGCTGAAGATGAAGGG + Intergenic
1133366958 16:5217720-5217742 AGGGAAATTTCGAAGAAGAATGG - Intergenic
1133894912 16:9917382-9917404 AGGTAAATTCTTCAGATGAATGG + Intronic
1134914160 16:18055532-18055554 AAAGAAATTCTGAAAAAGAAAGG + Intergenic
1135998453 16:27271167-27271189 AATGTTATTCTGAAGATTAAAGG + Intronic
1137351242 16:47715785-47715807 AGTCACATTCTGAAGCTGGAAGG + Intergenic
1137451256 16:48576891-48576913 AATAAAAGTGTGAAGATGAAAGG - Intronic
1139688118 16:68620231-68620253 AGTCAAATTCTGCAGCTGATAGG - Intergenic
1140338280 16:74132424-74132446 AGTGAAGTTATGAATTTGAAAGG - Intergenic
1141858939 16:86703598-86703620 AGAAAAATTCTGGAGATGGATGG + Intergenic
1142765302 17:2061047-2061069 ACAGAGGTTCTGAAGATGAAAGG + Exonic
1144182212 17:12762867-12762889 AGTGGAATTCCCAAGAGGAAAGG + Intronic
1144198079 17:12914950-12914972 TGTGAAAATCTGAACAGGAAAGG + Intronic
1144565657 17:16356969-16356991 AGTGAAAAACTGAAAATTAAAGG + Intergenic
1145848376 17:28065300-28065322 AGTTAAATTTTGATGATGACAGG + Intronic
1146613671 17:34333362-34333384 AGTGAATTTCTCAAGATCACAGG + Intergenic
1149169768 17:53795138-53795160 AGAGAGAGTCTGAAGCTGAAGGG - Intergenic
1149311864 17:55402234-55402256 AGTGAAATTCTGAAGATGAATGG + Intronic
1149401568 17:56301709-56301731 GGTGAAACTCTGAACCTGAATGG + Intronic
1150591751 17:66568800-66568822 AGTGTAAGTCCAAAGATGAAAGG - Intronic
1150998706 17:70349330-70349352 TCTAAAAGTCTGAAGATGAATGG + Intergenic
1153000073 18:446856-446878 CTTTAAATTCTGAAGATAAATGG - Intronic
1153595028 18:6716518-6716540 AGTCAAAATCTGAATATCAAAGG + Intergenic
1155573010 18:27215811-27215833 ATGGAAATTATGAAGATTAATGG + Intergenic
1155666940 18:28321025-28321047 AGTGAATTTTTGAATATAAATGG + Intergenic
1155875683 18:31084455-31084477 AGAGAAATTCTGATGTTTAAAGG + Intronic
1156279006 18:35614558-35614580 AGTGCAATTGTGAAGAGGCAGGG - Intronic
1156323189 18:36047335-36047357 AGAGAAATTCTGAATACCAAAGG + Intronic
1156776863 18:40801044-40801066 AATCACATTCTGAATATGAATGG - Intergenic
1156940751 18:42764669-42764691 AGTTAAATTCTGAGGATAAAAGG - Intronic
1157887451 18:51382852-51382874 AGGGTTATTGTGAAGATGAAAGG - Intergenic
1158076732 18:53538695-53538717 AGTGAAGTTCTAGAGATGGATGG + Intergenic
1158775778 18:60577208-60577230 AGTGAAAATCTGAAGAAAAATGG - Intergenic
1159309445 18:66688027-66688049 GGGGAAAGACTGAAGATGAATGG - Intergenic
1159713200 18:71789246-71789268 AGTTACATTCTGAATATCAATGG + Intergenic
1162239546 19:9338527-9338549 AGTCAAAATTTGAAGAGGAAAGG + Exonic
1164260489 19:23564883-23564905 AGTCAAATCATGAAGGTGAAGGG + Intronic
1164290544 19:23865119-23865141 AGTGAAATAGACAAGATGAATGG + Intergenic
1164456946 19:28416569-28416591 AATCAAATTCTAAAGATCAAGGG - Intergenic
1164696269 19:30246909-30246931 AGTGAAATTCTCATCATGAATGG + Intronic
1164927455 19:32141205-32141227 ACTGAACTGCTGAGGATGAAGGG - Intergenic
1165878497 19:39026360-39026382 AGTGACATTCTGATGATGCCTGG - Intronic
1167876123 19:52414182-52414204 ACTGAAATTCACAAGGTGAATGG - Intronic
1167883418 19:52481221-52481243 AGTGAAATTGATCAGATGAATGG - Intronic
1168677177 19:58286997-58287019 AATGAAATGGAGAAGATGAAGGG - Intronic
925062912 2:906737-906759 AATGAACTTCTGAATAAGAAAGG + Intergenic
926691499 2:15737449-15737471 GGTGAAAGTCGCAAGATGAAAGG + Intronic
926918244 2:17914094-17914116 GGTGAAATTCTGTAGTTGCAAGG - Intronic
927056775 2:19372823-19372845 CTTGAAGCTCTGAAGATGAACGG + Intergenic
927778333 2:25919357-25919379 GGTGAAATTCAGAGGATGAGTGG + Intergenic
928651716 2:33410953-33410975 AGTGAGACTCTGAAAAAGAAAGG - Intergenic
928993115 2:37256523-37256545 AGTTGAATTTGGAAGATGAATGG + Intronic
929175868 2:38975463-38975485 AGTGATAAACAGAAGATGAAAGG - Intergenic
930033116 2:47070167-47070189 AGTGGAATTCTGAAAAGGCAAGG + Intronic
930297356 2:49571486-49571508 AGTGAATTTCAGTAAATGAATGG - Intergenic
930341621 2:50123293-50123315 GGTGAACTTGTAAAGATGAAAGG + Intronic
930503525 2:52254430-52254452 AGTTAAATTTTGAAAATTAATGG + Intergenic
930906359 2:56572994-56573016 ACTAAAATTGTGAAGATGTAGGG + Intergenic
931132628 2:59354383-59354405 AGGGTAGTTGTGAAGATGAAAGG - Intergenic
932219424 2:69988580-69988602 GAAGAAGTTCTGAAGATGAATGG + Intergenic
933538753 2:83611470-83611492 AGTAATATTTAGAAGATGAAGGG - Intergenic
934115310 2:88785000-88785022 ATTGAAATTGGGAAGAAGAAAGG + Intergenic
934541175 2:95176291-95176313 GGTTACATTCTGGAGATGAATGG - Intronic
934581511 2:95444564-95444586 GGGAAAATTCTGGAGATGAACGG - Intergenic
934597939 2:95632150-95632172 GGGAAAATTCTGGAGATGAACGG + Intergenic
936479563 2:112873261-112873283 AGTCAACTTGTGATGATGAAAGG + Intergenic
936681297 2:114775355-114775377 AGTGAAATTCAGAACTAGAAAGG - Intronic
937012877 2:118577360-118577382 AATGAAATGCTGATGTTGAAAGG - Intergenic
937963106 2:127478448-127478470 AGAAGATTTCTGAAGATGAATGG + Intronic
938616328 2:133002861-133002883 AGTGAAAATGTAAAGATGCAGGG - Intronic
939186563 2:138868143-138868165 AATGAAGTTCTGCAGATGGAAGG - Intergenic
939351239 2:141040759-141040781 AGGGCAATTCTGAAGATGCTGGG + Intronic
939623261 2:144446489-144446511 AATGGAGTCCTGAAGATGAAAGG - Intronic
940039409 2:149344603-149344625 TTTGTAATTCTAAAGATGAAGGG - Intronic
940411852 2:153373669-153373691 AAGAATATTCTGAAGATGAATGG - Intergenic
940770579 2:157835308-157835330 ATTGAAATTTTTCAGATGAAGGG - Intronic
941498416 2:166237467-166237489 ACTGCCATTCTGGAGATGAAGGG + Intronic
942111010 2:172682772-172682794 AGTGAAATTCAGAAGATTAATGG + Intergenic
942232355 2:173872423-173872445 AGTGAAATTTAGTAGATGAGGGG - Intergenic
943337804 2:186639974-186639996 AGTGTAATTGGGAAAATGAAAGG - Intronic
943340830 2:186679805-186679827 ACTGTAATTCTGAATCTGAAAGG + Exonic
943595874 2:189855399-189855421 TTTGAAATTGAGAAGATGAATGG - Intronic
943910030 2:193552213-193552235 ATGGAAATTCTGAAGTTTAAAGG + Intergenic
945459927 2:210094111-210094133 AAAAAAATTCTGAAGATGGATGG + Intronic
945777953 2:214130957-214130979 AGTGGATTTCTGAAGGTGAAGGG - Intronic
946201720 2:218074351-218074373 AGGGATATTGTGAGGATGAACGG + Intronic
946536442 2:220634959-220634981 AGTGCTATTGTGAAGATGAAAGG + Intergenic
947314101 2:228836320-228836342 TGTGGAAGACTGAAGATGAAAGG - Intergenic
947374894 2:229485697-229485719 AGTCAGATTATGAAGAAGAAGGG + Intronic
947500091 2:230665246-230665268 AGTGAAAGTCTGAAGGGTAAGGG - Intergenic
948673899 2:239585674-239585696 AGGGGAATTCTGAGGAGGAAAGG + Exonic
1168905155 20:1397337-1397359 ATTGAAATTGACAAGATGAACGG + Intergenic
1168988028 20:2067475-2067497 AGAAAAGTTCTGGAGATGAATGG + Intergenic
1169886238 20:10401310-10401332 ATTCAAATTCTGTAGATGATTGG + Exonic
1169934451 20:10867764-10867786 AGTAACATTCTGAAAAAGAAGGG + Intergenic
1170992592 20:21317261-21317283 AGGGAAATTCTCAACATAAAGGG - Intronic
1172748307 20:37230842-37230864 GGTGTAATTGTGATGATGAAGGG + Intronic
1173867247 20:46320264-46320286 AGTGAAATTCTCAGCATGACTGG + Intergenic
1175147895 20:56910651-56910673 AGTGAAATTTTGCAGATTCAAGG + Intergenic
1177145066 21:17398505-17398527 AATGAAATTGTGAAAATAAAGGG + Intergenic
1177308479 21:19353294-19353316 AGTGATATTCTAAATATCAAAGG + Intergenic
1177553516 21:22658144-22658166 AGTTAAATTCTAAATATTAAAGG - Intergenic
1177828581 21:26111424-26111446 AGATATATACTGAAGATGAAAGG + Intronic
1178744707 21:35237770-35237792 AGCTAAATGCTGAAGATGTAAGG - Intronic
1179373450 21:40828295-40828317 TGTGGAATTCTGGACATGAATGG + Intronic
1179614971 21:42577488-42577510 ACTGAAATACTGAAAATGTAAGG + Intronic
1179885495 21:44312592-44312614 AGTGAGATTCTGGACATGCATGG + Intronic
1181911416 22:26241264-26241286 AGTGAAGATCAGAAGAGGAATGG + Intronic
1184267011 22:43353600-43353622 ATTAAAATTCTGAAGATGGATGG - Intergenic
949386518 3:3508585-3508607 ATTGAAATTCTGATGAGGGAGGG + Intergenic
950723868 3:14903123-14903145 AGAGAAGTTCTGGAGATGAATGG - Intronic
951204067 3:19907441-19907463 ATGGAAATCCTGAAGATCAAGGG + Intronic
952285549 3:31964852-31964874 GGGGAAAATCTGAATATGAATGG + Intronic
955487983 3:59454071-59454093 AGTTAAATCTTGAAGAGGAAGGG + Intergenic
955842900 3:63130841-63130863 AGTGAAACCCAGAAAATGAAGGG + Intergenic
955929314 3:64040043-64040065 AGTGAGATTCTGAGCAAGAATGG - Intergenic
955989112 3:64606064-64606086 AGTGGAATGATGAAGATGTATGG + Intronic
956403473 3:68904561-68904583 AGTGAAATTATCAATATGAATGG + Intronic
956606323 3:71076446-71076468 AGAGTTATGCTGAAGATGAAAGG + Intronic
957361777 3:79168965-79168987 AGCAAAATTCTAAAGATAAAGGG + Intronic
957963061 3:87284705-87284727 AGTTAAATTCTGAATTTTAAAGG + Intergenic
958584781 3:96072224-96072246 AGAAACATTCTGAAAATGAAAGG - Intergenic
958904748 3:99929400-99929422 ATAGAAATTTTGAACATGAATGG - Intronic
960779833 3:121307494-121307516 ATGGAAATTCTGGAGTTGAAAGG + Intronic
961754169 3:129117705-129117727 CGTGAGATTCTGAAAGTGAATGG - Intronic
961854491 3:129856243-129856265 AGTGAATTTCTGAACCTGAATGG + Intronic
962068812 3:132011876-132011898 AAGGAAATTCAGAATATGAAAGG - Intronic
963410633 3:144922524-144922546 AGGGAAATTGTGGACATGAATGG - Intergenic
963854314 3:150238268-150238290 AGAGAAATTCTGAAGAAAACTGG - Intergenic
964301902 3:155297360-155297382 AAACAAATTCTGAAGTTGAAAGG + Intergenic
965410485 3:168324410-168324432 AATGAAATTCTGAGTAAGAAAGG + Intergenic
965832301 3:172806227-172806249 AGTGAAAGTGTTAAGATGAGGGG - Intronic
966620066 3:181953716-181953738 AATGAAAGACTGAAGTTGAAAGG + Intergenic
967234330 3:187369395-187369417 TGTGGAAGTCTGAAGATGCATGG - Intronic
967295822 3:187963767-187963789 TATGAAATGCTCAAGATGAAAGG + Intergenic
967659016 3:192082449-192082471 ATTGAAATTATGAAGGTGATGGG - Intergenic
969039936 4:4288317-4288339 AGTGAATTTATGAACATAAATGG - Intronic
970828683 4:20308860-20308882 AGTGACATTCTGATGCTAAAAGG + Intronic
971550942 4:27954798-27954820 ATAGAAATTCTGAAGACGAAAGG - Intergenic
971723827 4:30282551-30282573 AGAGACATGATGAAGATGAAGGG - Intergenic
971840026 4:31838959-31838981 TGTGAAATAGTGAAGATGATGGG + Intergenic
972531555 4:39965836-39965858 TGAAAAATTCTGGAGATGAATGG + Intronic
972999099 4:44923173-44923195 AGTGAAATTATCAAGAACAAAGG + Intergenic
973221029 4:47727634-47727656 AATGAAATTCTGTAGGTGAAAGG + Intronic
974758235 4:66241172-66241194 AGTGTAATTATTAGGATGAAGGG + Intergenic
975159418 4:71108802-71108824 AAAGAAATTCTGAAGTTGAAAGG - Intergenic
975190886 4:71460726-71460748 ACTGATATTCTGAAGGAGAAGGG + Intronic
976000249 4:80365988-80366010 AGAGAAGATCTGCAGATGAAAGG - Intronic
976055491 4:81060941-81060963 AGTGGCATTGTGGAGATGAAGGG - Intergenic
976501386 4:85794454-85794476 AGTAACACTTTGAAGATGAAAGG - Intronic
978296644 4:107213138-107213160 AGGCAAATGCTGGAGATGAAAGG - Intronic
978411756 4:108433756-108433778 AGTGAAATACTTAGTATGAAGGG + Intergenic
978597319 4:110392317-110392339 GGAGACATTCTGAAGATGGAAGG + Intronic
978968033 4:114766900-114766922 AGTGAAATTTTCAAGAATAAAGG - Intergenic
978984213 4:114989145-114989167 AGTGATTTTCTGTAGATGAAGGG + Intronic
979086278 4:116413377-116413399 AGTAAAACTCTGAACATCAAAGG - Intergenic
979887578 4:126048459-126048481 AAGGAAATTCTGAAATTGAAAGG + Intergenic
980708141 4:136526040-136526062 AGTGAAATTGTGAATTTGACAGG + Intergenic
981529474 4:145737966-145737988 AGTAAAATGCTGAGGAAGAAAGG + Intronic
982501651 4:156164593-156164615 AGTGAAAATATGAAGATCATGGG + Intergenic
984315364 4:178122905-178122927 GGTGAAATTCTAAAGAAAAATGG + Intergenic
984462010 4:180049346-180049368 TGTGCAATTCTGAAGATGCATGG - Intergenic
984495680 4:180494521-180494543 AGTGATAATCTGAAGATGATAGG + Intergenic
984523142 4:180824464-180824486 AGTCAAATGCTGAATATGACTGG - Intergenic
984753324 4:183299747-183299769 AGGGAAATGATGGAGATGAAAGG - Intronic
984803402 4:183734450-183734472 AGTAAAAATAAGAAGATGAATGG - Intergenic
985173895 4:187180433-187180455 AGAGAAATACTGAAGCTGGAAGG - Intergenic
985340982 4:188954334-188954356 AGTGAAAAGCTGAAGATGGCAGG + Intergenic
986028549 5:3873596-3873618 GGTGACAGTCAGAAGATGAATGG + Intergenic
986714200 5:10510991-10511013 AGGGAAATGCTGAAGAAAAAAGG + Intronic
986784573 5:11102080-11102102 AGTAAAATTCTGAGGAGGAAGGG - Intronic
987102966 5:14608708-14608730 AGTGAAATTCAGAAGGATAAAGG - Intronic
988018376 5:25591040-25591062 ATTAAAATTCTGAAGAGGATGGG - Intergenic
988043194 5:25913306-25913328 AGTGAAATGCTGAGGAAAAAAGG + Intergenic
988857926 5:35247214-35247236 AGGGAAATTCTGGGGATGGATGG - Intergenic
989020138 5:36995570-36995592 AATGTAAATCTGAAGATAAAAGG - Intronic
989085592 5:37672884-37672906 AGTAAAAGTCAGAAGATGAAGGG - Intronic
989230088 5:39074935-39074957 AGGGGCATTCTGAAGATCAAGGG - Intergenic
989728725 5:44621759-44621781 TGTGAAATATTGCAGATGAAAGG + Intergenic
990689584 5:58348548-58348570 ACTGGGATTCTGAAGATGGAAGG - Intergenic
991006088 5:61829327-61829349 AGGAAAATTCTGAAAATGATGGG + Intergenic
991447349 5:66714534-66714556 AGTAAAATTCAGATGAAGAAGGG - Intronic
992712683 5:79476194-79476216 ATTGAAATGATGAAAATGAAAGG + Intronic
993156990 5:84238374-84238396 TTTGAAATTCAAAAGATGAAGGG + Intronic
993964513 5:94344962-94344984 TGAAAAATTCTGAAGATGGATGG + Intronic
994052094 5:95373852-95373874 AGTGAAATTTAGACCATGAAAGG - Intergenic
995295645 5:110517996-110518018 AGAGACATACTGAGGATGAAAGG - Intronic
995766007 5:115619932-115619954 GGTGAAATATTGAAGATTAATGG - Intronic
995850262 5:116537553-116537575 GTTGAAACTCTGAAGAAGAAAGG - Intronic
995870248 5:116737088-116737110 AGTGAAATGAAGAACATGAACGG - Intergenic
997080243 5:130730150-130730172 CGTGAACTTCTGAAGATACAAGG - Intergenic
997834323 5:137179978-137180000 AGTGTTATTCTGAGGATGAAAGG - Intronic
998566310 5:143218992-143219014 ATAGTCATTCTGAAGATGAAAGG + Intronic
998897518 5:146815544-146815566 AGTGAAATACTTAAGAGGAAGGG + Intronic
999568804 5:152895416-152895438 AGGGAAAGTCTGCAAATGAATGG + Intergenic
999957911 5:156722294-156722316 AGACAAATTCTGCAAATGAAGGG + Intronic
1000347130 5:160323612-160323634 AGTGAAATTGTTGTGATGAAGGG + Intronic
1000541590 5:162548009-162548031 AGAGAAATTTTGAATGTGAAAGG - Intergenic
1002420363 5:179143458-179143480 ATAGAAATTCTGGAGTTGAATGG + Intronic
1002990132 6:2230887-2230909 AGTGAATTTCTCAAGGTGGATGG - Intronic
1004076667 6:12350182-12350204 AGAGACAATCTGAAGATGCATGG + Intergenic
1004679195 6:17875932-17875954 AATGAAATTCTCAATATTAAAGG + Intronic
1004901341 6:20196981-20197003 ATTCAAATTCTGAAGTTTAATGG + Intronic
1004947217 6:20629469-20629491 GGTGAAAGTTTGAAGAGGAAGGG - Intronic
1005642510 6:27809997-27810019 AGTGAGAGTCTGAAGCTGATTGG - Intergenic
1006229077 6:32566807-32566829 ATTGAAATTGACAAGATGAATGG - Intronic
1006778746 6:36617301-36617323 AGTGCAATTCTCAAGATCACAGG - Intergenic
1006970936 6:38043964-38043986 CATGTAATTCTGTAGATGAAGGG - Intronic
1007381706 6:41494363-41494385 AGTGAAATTGTCAAGAGGCAGGG - Intergenic
1008155092 6:48004231-48004253 AGTGAAAATCTGTATCTGAAAGG + Intronic
1009818767 6:68772313-68772335 AGGGAAATACAGAAGATGGATGG + Intronic
1010432453 6:75793937-75793959 AGTGACTTTCTAAATATGAATGG + Intronic
1010449148 6:75982954-75982976 AGGGACATTCTCTAGATGAAGGG - Intronic
1010475955 6:76287554-76287576 GAAGAAGTTCTGAAGATGAATGG - Intergenic
1010867716 6:81000450-81000472 ATTGAAATTCTGATATTGAATGG + Intergenic
1011119357 6:83933842-83933864 AGTGAAAAGCTGAAGATGGTAGG - Intronic
1011413371 6:87090016-87090038 TCTGAAATGCTGAGGATGAAAGG - Intronic
1011430650 6:87283231-87283253 AGTGAATTCCTGATTATGAAAGG + Exonic
1011493002 6:87911811-87911833 GGTGAACTTCCAAAGATGAAGGG - Intergenic
1012581637 6:100877259-100877281 AGTGATATACTGCAGATTAAGGG + Intronic
1013690844 6:112640945-112640967 AGAGAAATTCTGAAAGTGAAAGG + Intergenic
1014141384 6:117947334-117947356 AATGAGATTCTAGAGATGAAAGG + Intronic
1014333361 6:120099306-120099328 AGAGAAATACTGAAAATAAAAGG + Intergenic
1014499532 6:122168407-122168429 ACTGAAATCCTGTAGATGAAGGG + Intergenic
1014826056 6:126049901-126049923 AGTCAAGTTCAGAAGATGATAGG + Intergenic
1014934863 6:127375416-127375438 ATAGAAATCCTGAAGTTGAAAGG - Intergenic
1015940515 6:138446736-138446758 AGAGACACTCTTAAGATGAATGG + Intronic
1016319269 6:142824631-142824653 TGTGAGATTCTGAAGAAGAGTGG - Intronic
1016703086 6:147076052-147076074 TGTGTCATTCTGAAGATTAAGGG + Intergenic
1017919661 6:158860292-158860314 AGTGACATTTTGAAGATTACAGG + Intergenic
1018095588 6:160384729-160384751 AGAGAAATTCTGAGGGTGGAAGG - Intronic
1018426995 6:163692096-163692118 AGTGAATTTTTCAAGATGAGAGG + Intergenic
1018884909 6:167927164-167927186 GGAGAAATTAAGAAGATGAATGG + Intronic
1019007472 6:168812258-168812280 GGTGAAATTTTGAAGTGGAAAGG + Intergenic
1020378379 7:7514269-7514291 AGTGCCATTATGAAGAGGAAAGG - Intronic
1020469495 7:8519931-8519953 AGTGAGATTTTTAAGATGATAGG - Intronic
1020536973 7:9411463-9411485 AGTGAAGTTCTGAACTTCAAAGG - Intergenic
1020687463 7:11313350-11313372 TGTGAAATTGTGAAGACAAAAGG - Intergenic
1021318151 7:19176867-19176889 AATGACATTATGATGATGAATGG - Intergenic
1021578716 7:22129578-22129600 TGTGATATTCTGAAGATCACAGG - Intronic
1021982177 7:26065620-26065642 ATAGAAATTCTGAAATTGAAAGG + Intergenic
1022405283 7:30084020-30084042 AGTGAAATTCTCATGATACATGG - Exonic
1022883335 7:34613835-34613857 AGAGAAATTCTGAAGCTTAAAGG + Intergenic
1023582225 7:41695342-41695364 AGTGAAATCTTGATGAAGAATGG - Intronic
1023724750 7:43131406-43131428 AGTGAAAGGCTGAAAATGCAGGG - Intronic
1024396933 7:48880214-48880236 AGTGAAACACTGAAGATCACTGG + Intergenic
1025080481 7:55977725-55977747 GAAGAAATTCTCAAGATGAATGG - Intronic
1025163613 7:56690008-56690030 AGTGAAATTTGGAATTTGAAAGG - Intergenic
1025240847 7:57271544-57271566 AGTGAAATTTGGAATTTGAAAGG + Intergenic
1025612618 7:63090937-63090959 AGTGAAATTTGGAATTTGAAAGG - Intergenic
1026150852 7:67787117-67787139 AGTGAGACTCTGAAGAAGGAAGG - Intergenic
1026541042 7:71280265-71280287 AGGGAAACCATGAAGATGAAAGG - Intronic
1027008104 7:74714616-74714638 AAAGAAATTTTGAAGATGACTGG - Intronic
1027442320 7:78232628-78232650 TGAGAAATTCTGAAGAAAAATGG + Intronic
1027611952 7:80372597-80372619 TGTGGAATTCTGAAGATGAGTGG + Intronic
1027678596 7:81190246-81190268 AATGAAACTCTGAGGAAGAAAGG + Exonic
1028702495 7:93796720-93796742 AGTGAAAGTTTGAAGATACATGG - Intronic
1028706841 7:93858858-93858880 AGCCACATTCTGGAGATGAACGG + Intronic
1030010733 7:105164152-105164174 AGTGAACTAGTGAAGAGGAAAGG + Intronic
1030603401 7:111613761-111613783 AGTTATATTCTGAAGTAGAAAGG - Intergenic
1031131779 7:117841428-117841450 AGTGAAAGGATGGAGATGAAAGG - Intronic
1031921037 7:127600698-127600720 AGTGAAATTCTGCATCTTAATGG - Intronic
1032882153 7:136101311-136101333 AGTGACATTCTGATGAGCAATGG + Intergenic
1033120453 7:138663302-138663324 GCTGAAATCCTGAACATGAAGGG - Intronic
1035856741 8:2984098-2984120 AGTGACATTCTGAGAATAAAAGG + Intronic
1037711854 8:21361242-21361264 TGTGAAATTGTGAGGATAAAGGG - Intergenic
1039081944 8:33742235-33742257 ACTGAAATTCTGTACATAAAGGG - Intergenic
1039359955 8:36865456-36865478 AGTGTTATTCAGAAAATGAATGG + Intronic
1040464790 8:47684637-47684659 AGAGAAAGTCTGAGGAAGAAGGG - Intronic
1041050431 8:53929163-53929185 AGAGAAATTCTCAAGAAGCAGGG + Intronic
1041801403 8:61804410-61804432 AGTAAAATTCTGAGTATAAAGGG - Intergenic
1042485369 8:69340976-69340998 AATGAAATTGTGATGATGGAGGG - Intergenic
1042724388 8:71857319-71857341 AGAGAAATTCTGGAGCTAAAAGG - Intronic
1042965599 8:74348675-74348697 AATGAAGTTCTGAAGAGGAATGG + Intronic
1043105595 8:76106246-76106268 ACTGAAATTCAGAAGATTACAGG - Intergenic
1043375298 8:79642080-79642102 AGTGGGACTCTGAAGAGGAAAGG - Intronic
1043520843 8:81043829-81043851 AGTGAAATCCAGAAGAACAAAGG - Intronic
1043544415 8:81299336-81299358 AATCAAATTCTGAAGCTCAAGGG + Intergenic
1044093636 8:88034013-88034035 AGTGAAATGCTGAGTATGATGGG - Exonic
1044187530 8:89273056-89273078 AGAGGAATTCTAAAGAAGAAAGG + Intergenic
1044257006 8:90075708-90075730 AGAGAAATTCTGAAAATAATTGG - Intronic
1046128167 8:109936535-109936557 AGAGACATTCTGAATAAGAATGG + Intergenic
1046341658 8:112866233-112866255 AGTGGAAATATGAAGATGCAGGG - Intronic
1046412302 8:113861838-113861860 TATGAATTTCTGAAGATCAAAGG + Intergenic
1046497074 8:115027823-115027845 AGTGAAACTCTGAATGTGAAAGG - Intergenic
1047303338 8:123633820-123633842 AGAGAAATAATAAAGATGAATGG - Intergenic
1048052676 8:130833304-130833326 AGTAACATTCTGAAGAACAAAGG - Intronic
1048603961 8:135948119-135948141 ACTGAAATACTGAAGATTCAAGG - Intergenic
1049066018 8:140314831-140314853 AGTGCCATTCAGCAGATGAATGG - Intronic
1050362477 9:4843748-4843770 AGTGAAGATTAGAAGATGAAGGG - Intronic
1050716337 9:8530746-8530768 AGAGAGATTCTGAATGTGAATGG + Intronic
1052299510 9:26937721-26937743 AAAGAAATTATGAAGATGAAAGG + Intronic
1052597410 9:30577097-30577119 AGAGAAGTTCTGGAGATGTATGG + Intergenic
1052687708 9:31775692-31775714 AGTGAAAACCAGAAGCTGAAAGG - Intergenic
1053165993 9:35844181-35844203 AGTGAATTTTTGAACCTGAATGG + Intronic
1054862730 9:69969957-69969979 AGTGTAAATCTGAAAATGGAAGG + Intergenic
1055237934 9:74147033-74147055 AGGGAAATTCTAAATATGAGAGG + Intergenic
1055834456 9:80421773-80421795 AGTGGAATTCAGAAGATAGAGGG - Intergenic
1055971419 9:81916156-81916178 AGGAGAATTCTGAAGATGCAGGG - Intergenic
1055973146 9:81931202-81931224 AGGAGAATTCTGAAGATGCAGGG - Intergenic
1055974899 9:81946294-81946316 AGGAGAATTCTGAAGATGCAGGG - Intergenic
1055979939 9:81991520-81991542 AGGTGAATTCTGAAGATGCAAGG - Exonic
1056289056 9:85123754-85123776 AGGGAAATTCTAAAAATAAAAGG + Intergenic
1056749235 9:89334841-89334863 AATGAGTTTCTGAAGATGGATGG + Intronic
1058267488 9:102921508-102921530 AAAAAAGTTCTGAAGATGAAGGG + Intergenic
1058350881 9:104022502-104022524 AATGAATTTCTAAAAATGAAAGG + Intergenic
1058489894 9:105486610-105486632 GGTGAAATTCTGAAGTTTTAGGG - Intronic
1058875542 9:109241619-109241641 AATGAAACTATGAAGGTGAATGG + Intronic
1059162167 9:112045170-112045192 AATACAATTCTGGAGATGAACGG + Intronic
1059614284 9:115931984-115932006 AATGAAATTCTGCAGAGGTAGGG - Intergenic
1059621368 9:116009319-116009341 AATCAAGTTCTGAAGATGGATGG - Intergenic
1060132288 9:121114835-121114857 TGTAAAATTCTCAACATGAAAGG - Intronic
1185942190 X:4334076-4334098 AGTCAAATTCTGAAGTTCTATGG - Intergenic
1186097417 X:6117104-6117126 AGTGAGCTCCTTAAGATGAATGG - Intronic
1186387648 X:9126136-9126158 AGTGAGACCCTGAAGAAGAAAGG + Intronic
1186644100 X:11487928-11487950 AGTGAAAGTTTGATGACGAATGG + Intronic
1186850190 X:13572110-13572132 AGCCAAATTCTGAAGCTTAAGGG - Intronic
1187078587 X:15962043-15962065 AGTGTAATGCTAAAGATAAAAGG + Intergenic
1187205844 X:17180455-17180477 AGTGTAATTGTGAGGATTAAAGG + Intergenic
1187574170 X:20536837-20536859 AGTAACATTTTCAAGATGAAAGG - Intergenic
1187615947 X:20993091-20993113 AAAGAAGTTCTGAAGCTGAATGG + Intergenic
1188230213 X:27653173-27653195 AGTCATATTCTGGAGATTAATGG + Intronic
1188342173 X:29017366-29017388 AGTGATATTCAGATGATTAAAGG - Intronic
1188484290 X:30666114-30666136 AGTGAAATGCTGCAGGTGTATGG - Intronic
1188536017 X:31197557-31197579 AGAGAAATTCAGAAGATAGATGG + Intronic
1189621761 X:42848108-42848130 ATAGAAATTCTGGAGTTGAAAGG + Intergenic
1192334772 X:70209116-70209138 ACTGAAATCTTGAAAATGAAAGG + Intergenic
1192763818 X:74123034-74123056 GGTGCAATTGTGTAGATGAAAGG + Intergenic
1193974691 X:88102824-88102846 AGGGAAATTCTGCAGGTAAAGGG - Intergenic
1195019796 X:100815600-100815622 AAAAAAATTCTGGAGATGAATGG + Intergenic
1195215361 X:102694764-102694786 AAGGAAATTCTGGAGCTGAAAGG + Intergenic
1195525277 X:105881820-105881842 AGTTAAAAGCTGAAAATGAAAGG - Intronic
1195620437 X:106949218-106949240 ATGGAAATTCTGAAGGTGCAAGG - Intronic
1195741471 X:108068976-108068998 AATGAAATACTGGAGATCAAAGG + Intronic
1195835117 X:109105758-109105780 AGTCAAATTCTGAAGACCAAGGG - Intergenic
1196840337 X:119853339-119853361 TGGAAAACTCTGAAGATGAAAGG - Intergenic
1197120606 X:122886635-122886657 TGTGAAACTGTGAATATGAATGG + Intergenic
1197144938 X:123160947-123160969 AGTGTCTTTCTGCAGATGAATGG - Intergenic
1199225712 X:145370766-145370788 AGTGAAAATCTAAACATTAAAGG + Intergenic
1202019461 Y:20449740-20449762 AGTGAAAGGCTGAAGCTGGATGG - Intergenic