ID: 1149312591

View in Genome Browser
Species Human (GRCh38)
Location 17:55409369-55409391
Sequence TCTAGAAAACAGAATTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 788
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 721}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149312591_1149312593 16 Left 1149312591 17:55409369-55409391 CCTTTCTAATTCTGTTTTCTAGA 0: 1
1: 0
2: 5
3: 61
4: 721
Right 1149312593 17:55409408-55409430 GAGTAGGTAGACAACAGACCTGG 0: 1
1: 0
2: 0
3: 14
4: 139
1149312591_1149312592 0 Left 1149312591 17:55409369-55409391 CCTTTCTAATTCTGTTTTCTAGA 0: 1
1: 0
2: 5
3: 61
4: 721
Right 1149312592 17:55409392-55409414 TTGTCATACGCTGTTAGAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149312591 Original CRISPR TCTAGAAAACAGAATTAGAA AGG (reversed) Intronic
900404856 1:2488209-2488231 TTTAGGAAACAGAAGTAGATGGG + Intronic
900908760 1:5579272-5579294 TCTGGAAAGCAGAATGAGCAAGG - Intergenic
903641947 1:24866179-24866201 TCTACAAAAGAAAATAAGAAAGG + Intergenic
904780195 1:32940892-32940914 TCTAGCAAATGGAAATAGAAAGG + Intronic
905737958 1:40343715-40343737 TCTAGAAAAGAGAAAAGGAAAGG - Intergenic
906911395 1:49955350-49955372 TACAGAAAACAGAATTACATTGG + Intronic
907234331 1:53031297-53031319 TATAGAGAAAAGAATTAAAATGG - Intronic
907582107 1:55581802-55581824 TCTACAAAACAGAAATAATAAGG + Intergenic
907618394 1:55949135-55949157 TCTACAAAAAGGAATTAGATTGG - Intergenic
907695790 1:56727334-56727356 TCTAGAAGATATACTTAGAAGGG - Intronic
908024631 1:59937707-59937729 TCTAGAAAATAGCATCAAAAGGG - Intergenic
908093204 1:60708192-60708214 TCTAGAAAACAGCTTCAAAAGGG + Intergenic
908100820 1:60789213-60789235 TCTAGAAAAAAAAATTAGCTGGG - Intergenic
908390157 1:63676918-63676940 TTTGGAAAACTAAATTAGAAAGG + Intergenic
908678408 1:66631913-66631935 TCTTAAAAACTGAATTAAAATGG + Intronic
908810085 1:67972871-67972893 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
909582634 1:77254961-77254983 TATAGAAAACAGCATCAAAAGGG + Intergenic
910041513 1:82857518-82857540 TCTACAAAACAGAATTTGGCTGG - Intergenic
910290012 1:85590535-85590557 TCTAGAAAATAGCATCAAAAGGG + Intergenic
910303081 1:85729537-85729559 TCTACAAAGCAGAAATATAAAGG + Exonic
910577721 1:88785287-88785309 TCTAGAAAAAAAAATTAGCCAGG - Intronic
910627303 1:89321662-89321684 TCTAGAAAACAGCCTCAAAAAGG - Intergenic
910691788 1:89972959-89972981 TTTAGAAAACAGATTTTGTAAGG + Intergenic
910697007 1:90029983-90030005 ACTTGAAAACAGAAGTTGAAAGG - Intronic
910801194 1:91148353-91148375 TCTAGAAAATAGCCTTAAAAGGG - Intergenic
910995434 1:93099684-93099706 TCTAGAAAGCAGAGTGATAAGGG + Intronic
911182045 1:94869836-94869858 TCTGGAAATCAGATTTAAAAAGG + Intronic
911291533 1:96062184-96062206 TCCAGAAATCATAATTAAAATGG + Intergenic
911343772 1:96672655-96672677 TCTAGAAAATAGCCTCAGAAAGG - Intergenic
911373835 1:97025966-97025988 TCTAGAAAATAGCATCAAAAGGG + Intergenic
911378181 1:97077246-97077268 TCTAGAAAAGAGATTTACCAGGG - Intergenic
911537796 1:99121380-99121402 TCAGAAAAACATAATTAGAAAGG + Intergenic
911698290 1:100919683-100919705 TATATAAAAGAGAATTAGAAAGG - Intronic
911705828 1:101011649-101011671 TCTATAAAACAGATTTATATGGG + Intronic
912015501 1:105028850-105028872 TCTAGAAAATAGCATCAAAAGGG + Intergenic
912601290 1:110935697-110935719 TCTAGAAAATAGCCTCAGAAGGG + Intergenic
912871749 1:113312957-113312979 TCTAGAAAACAGCCTCAAAAAGG + Intergenic
912899092 1:113629057-113629079 TCTAGAAAACAGCCTCAAAAGGG - Intronic
913032383 1:114922272-114922294 TCTAGAAAACAGCCTCAAAAGGG - Intronic
913359875 1:117968542-117968564 TATAGAAAACAGTATTATACAGG - Intronic
913547998 1:119888387-119888409 TCAAGAAAAAAAAATTAGCAAGG + Intergenic
914394769 1:147254848-147254870 TCTGGAACACAGAAAAAGAAAGG - Exonic
915659824 1:157394055-157394077 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
915966395 1:160312446-160312468 TTTAAAAAACAGAATCACAAAGG - Intronic
916341664 1:163743904-163743926 TCTAGAAAACAGCCTTAAAGGGG - Intergenic
916345709 1:163788984-163789006 TTTAGAGAATGGAATTAGAAGGG - Intergenic
916632653 1:166633204-166633226 TCTAGAAAATAGAAAAGGAAAGG + Intergenic
916968787 1:169985383-169985405 TTTAGAAAACAGAACCAAAATGG + Intronic
917519419 1:175735694-175735716 TATGGAAAACAAAATTATAAAGG + Intronic
917986447 1:180325237-180325259 TCTAGAAAACAGCCTCAAAAGGG - Intronic
918370289 1:183854159-183854181 TCTATAACACAGAGTTATAAAGG + Intronic
918960947 1:191276840-191276862 TCTAGTAAGTAGAATCAGAAGGG + Intergenic
919100361 1:193089174-193089196 GCTAGATAACATAATTACAAAGG - Intronic
919200599 1:194350228-194350250 TCTAGAAAACAGGATAAAATTGG + Intergenic
919263642 1:195233120-195233142 TGTTGAAAACAAAATTAGATAGG - Intergenic
919336820 1:196245847-196245869 TCTAGAAAACAGCACCAAAAGGG + Intronic
921224618 1:213005860-213005882 TCTAGGCAACAGAAATAGCAAGG - Intronic
921295935 1:213703968-213703990 TCTAGAAAATAGCCTTAAAAGGG - Intergenic
921539723 1:216398916-216398938 TTTAGAAAAGAGAATCAGAGTGG - Intronic
921845627 1:219876670-219876692 TCCAGAAAACAGATTTTGAGGGG + Intronic
922044476 1:221930041-221930063 TCTAGAAAATAGTCTCAGAAAGG + Intergenic
922386502 1:225089493-225089515 AAAAGAAAACAGATTTAGAAAGG + Intronic
922997595 1:229977085-229977107 ACTTGAAACCAAAATTAGAATGG - Intergenic
923636855 1:235706777-235706799 TCTAGAAAAGAGAATAAGATAGG - Intronic
924562477 1:245168472-245168494 TCTAGAAGAGAGATTTAGTATGG + Intronic
1063236270 10:4119762-4119784 TCTAGAAAACTGAAGTAGAATGG + Intergenic
1064370461 10:14748113-14748135 ACAAGTAAACAAAATTAGAATGG - Intronic
1064646572 10:17465648-17465670 TCAAGAAGAGAGAATTGGAAGGG + Intergenic
1064909367 10:20383727-20383749 TATAGAATTCAGAATTAAAAGGG + Intergenic
1064937410 10:20693373-20693395 TATAGACAACAGAAATAGAAAGG - Intergenic
1066279537 10:33901980-33902002 TATAGAAACAACAATTAGAAAGG + Intergenic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1067010725 10:42711094-42711116 TGTGGAAAACATAATTAGAAAGG + Intergenic
1067312785 10:45130106-45130128 TATGGAAAACGTAATTAGAAAGG - Intergenic
1067373431 10:45705717-45705739 TTGAGAAAACAGAAGCAGAAAGG + Intergenic
1067380262 10:45766497-45766519 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1067700241 10:48566435-48566457 TCCAGAATACAGATTTAAAAAGG + Intronic
1067862467 10:49866227-49866249 TCAAGAAAACAGAAATGGCATGG - Intronic
1067887963 10:50107151-50107173 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1068568683 10:58604733-58604755 TTTAGAAAACATAGTTGGAATGG + Intronic
1069193298 10:65518142-65518164 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1071141053 10:82509944-82509966 GCGAGAAAACAGGAGTAGAAAGG - Intronic
1071178143 10:82951439-82951461 TTTGAAAAACAAAATTAGAATGG - Intronic
1071231482 10:83592228-83592250 ACTAGAAAACACAATTATATAGG - Intergenic
1071822744 10:89294664-89294686 TTTTGAAAAAAGAATAAGAATGG + Intronic
1072074086 10:91950989-91951011 TCTATAAAAAATAATTAGCAGGG - Intronic
1072282678 10:93882706-93882728 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1073772674 10:106752529-106752551 TTTAGCATACAGAATTAGAGTGG + Intronic
1074037668 10:109757186-109757208 ACAAAAAAACAAAATTAGAAGGG - Intergenic
1074166534 10:110882427-110882449 TTTAGAAAACAGAATTTTCAGGG + Intronic
1074664775 10:115708508-115708530 TCTAACAAACAGTATTAAAAAGG - Intronic
1074684053 10:115942215-115942237 TCTACATAACAGAATTAGCAGGG - Intronic
1074750002 10:116576489-116576511 TCTAGAAAAGATAATCTGAAAGG - Intergenic
1074805754 10:117049946-117049968 TCAAGAAAATAGAAAAAGAAGGG + Intronic
1074822750 10:117193601-117193623 TCTTGAAAACAGAATAAGGCAGG + Intergenic
1074957254 10:118404324-118404346 TCTAGACAGCAGAAATAAAAGGG - Intergenic
1076227313 10:128789821-128789843 TCTAGAAAACAACATGAAAAGGG + Intergenic
1076348507 10:129797327-129797349 TCTATAAAACAGCATTTTAAAGG - Intergenic
1078244477 11:9561729-9561751 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1078671707 11:13371514-13371536 AGTAGAAAACAGAAGTAGGAAGG - Intronic
1078816766 11:14831472-14831494 TCTAGAAAGAGAAATTAGAAGGG + Intronic
1078992850 11:16666860-16666882 TCTAGAAAATAGTCTTAAAAGGG + Intronic
1079069087 11:17327566-17327588 TCTAGAAAACAGCCTCAAAACGG - Intronic
1079183707 11:18216791-18216813 TCTAGAAAACAGTCTCAGAAAGG + Intronic
1079486608 11:20941712-20941734 TCTAGAAATCAGGATCAGATAGG - Intronic
1080327724 11:31097109-31097131 TTCAGAAAACAAAATTATAATGG - Intronic
1081426621 11:42932817-42932839 TCTAGAAAACAAAATTAGACAGG + Intergenic
1081697853 11:45129126-45129148 ACCAGAAAACAGGAATAGAAAGG + Intronic
1082965072 11:58958901-58958923 GTTAGAAAACAAAATTAGATGGG - Intronic
1082968495 11:58993587-58993609 TCTAGAAAAGAGAAGTAAAATGG - Intronic
1083102561 11:60324606-60324628 TCAGGAAAACAGATTTAAAAAGG + Intergenic
1083605682 11:63977292-63977314 TCTTGAAAAAAAAATTAAAAAGG - Intronic
1083824615 11:65192409-65192431 TCTAGGAAACAGAAAAAGAGAGG - Intronic
1084096482 11:66914867-66914889 TCTAGAAAAAAAAATTAGCTGGG + Intronic
1084431072 11:69111576-69111598 ACTGCAAAACAGAATTGGAAGGG - Intergenic
1084903644 11:72329178-72329200 TTGGGAAAACAGAATTAGAATGG + Intronic
1084973341 11:72783003-72783025 TCCAGAAAAGGGAATCAGAATGG + Intronic
1085981496 11:81731775-81731797 TCTAGAAAACAGCTTCAAAAGGG - Intergenic
1086033264 11:82385236-82385258 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1086218437 11:84411378-84411400 TCTAGTAACCAGAAGTAGGAAGG - Intronic
1086277185 11:85145466-85145488 TCTAGAAAACAGTCTCAAAAGGG - Intronic
1086496305 11:87407544-87407566 TCTAGAAACTTGAATTTGAATGG + Intergenic
1086521053 11:87668111-87668133 TCTTGAAAACATAAATGGAATGG - Intergenic
1086571664 11:88291836-88291858 TCTAGAAAAAAAAATCAGATGGG - Intergenic
1086582141 11:88411664-88411686 TCTAAAAAAAAGAAAAAGAAAGG - Intergenic
1087031791 11:93713801-93713823 TCTAGAAAATAGCTTTAAAAGGG - Intronic
1087854168 11:103071142-103071164 TCTAGAACCCAGAAAAAGAAAGG + Intronic
1087950649 11:104217389-104217411 TCTAGAAAACAGACTCAAAGGGG - Intergenic
1088270946 11:108033919-108033941 GCTAGCAAACAGAATTAGTGGGG - Intronic
1088389041 11:109292952-109292974 TCTAATAAACAGATTTAGTATGG + Intergenic
1088436943 11:109824393-109824415 TATAGAAAACAGAATTAGAGAGG - Intergenic
1088450391 11:109975564-109975586 TTTGGAAATCAGAATTAAAATGG + Intergenic
1088455318 11:110027286-110027308 TCTAGAACAGAGGATTGGAAGGG - Intergenic
1088519977 11:110686781-110686803 TCCAGAATACCGAATTAGAAAGG + Intronic
1088537014 11:110872490-110872512 TGTAGAAGCAAGAATTAGAAAGG - Intergenic
1088724098 11:112619334-112619356 TCTAAAAGACACAAGTAGAAAGG - Intergenic
1089415665 11:118288012-118288034 TTTATAAATCAGTATTAGAAGGG + Intergenic
1090065088 11:123496590-123496612 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1090649600 11:128794583-128794605 TCTATAAAAAGGGATTAGAAAGG - Intronic
1090725606 11:129524189-129524211 GAGAGAAAACAGAATTAGAATGG + Intergenic
1091336256 11:134768795-134768817 CCTAGAAAACAGCCTCAGAAAGG + Intergenic
1092601951 12:10076653-10076675 TCTAAAACACAGAACAAGAATGG + Intronic
1092882956 12:12902030-12902052 TCTAGAAAGCAGCATTTGAGAGG - Intronic
1093578025 12:20757307-20757329 ACTTGAAAACAGAATGAGAGAGG + Intergenic
1095264140 12:40133751-40133773 TCTAGGAATCAGAAGGAGAATGG - Intergenic
1095267116 12:40173566-40173588 AGGTGAAAACAGAATTAGAAAGG + Intergenic
1095315783 12:40759465-40759487 TCTAAAAAAGAGAAAGAGAAAGG - Intronic
1096170077 12:49461016-49461038 TCCAGGAAACAGAACCAGAAGGG + Exonic
1096543936 12:52324080-52324102 CCTTGAAAACAGACTTAGACAGG + Intergenic
1096984127 12:55745160-55745182 TCTAGGAAACAGAGTTATAGAGG + Intronic
1097146838 12:56947254-56947276 TCTAGAAAACAGACTTAAAAGGG - Intergenic
1097150596 12:56976587-56976609 TCTAGAAAATAAACTTAGAAGGG - Intergenic
1097370642 12:58775646-58775668 TCTAGAAAATAGAGGTATAATGG - Intronic
1097508785 12:60509038-60509060 TCTAGAAAATAGACTCAAAATGG + Intergenic
1098082069 12:66797711-66797733 TCTAGGTTAGAGAATTAGAAAGG - Intronic
1098117146 12:67191278-67191300 TCAAGAATACAGGATAAGAAAGG - Intergenic
1098206832 12:68119685-68119707 CCTAAAAGACAGATTTAGAAAGG + Intergenic
1099024666 12:77449715-77449737 TCTAGAAAACAGCTTCAAAAAGG + Intergenic
1099033085 12:77553502-77553524 TCTGGAAACCAGAATGATAAAGG + Intergenic
1099110830 12:78558711-78558733 TATAGAAAACAGACATTGAAAGG - Intergenic
1099900062 12:88696362-88696384 TCTTCATAACAGAATGAGAAAGG - Intergenic
1099947186 12:89258123-89258145 TCTAGAAAATAGGCTTAGATGGG - Intergenic
1099967206 12:89461306-89461328 TCTAGAAAACAAAAACAGAGAGG + Intronic
1100483772 12:95004895-95004917 TCTTAGAAACAGAAGTAGAATGG - Intergenic
1100851809 12:98719672-98719694 TCAAGAAAACAGAATCCTAAAGG - Intronic
1101171900 12:102106135-102106157 TCTAGAAAACAGGCATGGAATGG + Intronic
1101749875 12:107574701-107574723 TCTATAAAAAAGAAAAAGAAAGG + Intronic
1102577723 12:113866970-113866992 TCTTGAAACCAAAATCAGAATGG - Intronic
1104334192 12:127877830-127877852 TCTGGAAAACTGCATTAGACAGG - Intergenic
1106809603 13:33347235-33347257 TCTCAAAAAAAGAAATAGAAAGG - Intronic
1106827202 13:33536648-33536670 TCTGAAAAGCAGAATTAAAAGGG + Intergenic
1106982644 13:35306696-35306718 TCAGGAAAACAGAAAGAGAAAGG - Intronic
1107138809 13:36975589-36975611 TCTATAACATAAAATTAGAAAGG - Intronic
1107196902 13:37663271-37663293 TGCAGAAAACAGAATTAACATGG - Intronic
1107205521 13:37781193-37781215 TCTAGAAAATAGAACTAAGAAGG + Intronic
1107879384 13:44819769-44819791 TCTAGTAAACATAATTCGTAAGG + Intergenic
1107952852 13:45480103-45480125 TCTAGAAAACAGAACCAAAAGGG - Exonic
1108332126 13:49397859-49397881 TTTAAAAAACAGAATTATCAAGG + Intronic
1108441414 13:50456865-50456887 GCTAGAAAACAGAACAGGAAAGG - Intronic
1108631519 13:52288271-52288293 TCTAGAAAATAGCATCAAAAGGG - Intergenic
1108655173 13:52524324-52524346 TCTAGAAAATAGCATCAAAAGGG + Intergenic
1108667150 13:52644043-52644065 GCTACAAAACAGACCTAGAATGG - Intergenic
1108828635 13:54449589-54449611 TCTCCAAAACAGATTTAAAATGG + Intergenic
1109161440 13:58980159-58980181 TCTAGAACACAGAATAAAACAGG + Intergenic
1109211089 13:59536909-59536931 TCTAGAAAATAGACTTGAAAGGG - Intergenic
1109685329 13:65812606-65812628 TGTAGAAAACCAAATTGGAAAGG - Intergenic
1109747149 13:66640013-66640035 TCTAGAAAACTAAATTGGAAAGG - Intronic
1109861839 13:68209865-68209887 TCTACAAATCAGAATTATATTGG - Intergenic
1109923884 13:69107765-69107787 TCAAGAAAACAGCCTCAGAAGGG + Intergenic
1109930017 13:69203849-69203871 ACTAGACATCTGAATTAGAAAGG - Intergenic
1109997575 13:70149174-70149196 TCTTCAATACACAATTAGAAAGG - Intergenic
1110688601 13:78404664-78404686 CCTGGAAAACAGAAGTGGAAAGG + Intergenic
1110740987 13:78996485-78996507 TAGAGAATAAAGAATTAGAATGG + Intergenic
1111087084 13:83390138-83390160 TTTAGAAAAAAGAATAAGATAGG - Intergenic
1111278966 13:85992868-85992890 ACTAGAAAACAGTTTTAAAAAGG - Intergenic
1111541761 13:89677149-89677171 AAAAGAAAAAAGAATTAGAAAGG + Intergenic
1111554854 13:89867310-89867332 GCTAGAAAACAAAATTAAAGTGG - Intergenic
1112822042 13:103348999-103349021 TCGGGAAGAAAGAATTAGAATGG + Intergenic
1112928609 13:104707609-104707631 TCTACAAAGCAGTATAAGAACGG + Intergenic
1112941526 13:104867797-104867819 TCTATAAAACAGAATGACAGAGG + Intergenic
1113013385 13:105796713-105796735 TCTAGAAAATAAATTTAAAATGG - Intergenic
1113254072 13:108487424-108487446 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1113277487 13:108748181-108748203 ACTAGAAATCAGTAATAGAAAGG + Intronic
1113509456 13:110841363-110841385 CCTAGAAAACTGATTCAGAAGGG - Intergenic
1113631375 13:111887304-111887326 TCTAGTAACCAGAATATGAAAGG - Intergenic
1113858904 13:113468334-113468356 TCCAGAGACCAGAAGTAGAATGG + Intronic
1114385325 14:22248342-22248364 TCTAAAAAACAAAATTAGTCAGG - Intergenic
1114941766 14:27621905-27621927 TCAGGAAAACAGGAGTAGAAAGG + Intergenic
1115171721 14:30515533-30515555 TCTAGAAATCAGAAAGACAAGGG - Intergenic
1115374685 14:32661298-32661320 ACTAGCAATCAGAATTGGAAAGG + Intronic
1115563917 14:34607992-34608014 CCTAGAAAATGGAATTAAAATGG + Intronic
1115994519 14:39182192-39182214 TGTATGATACAGAATTAGAAGGG - Exonic
1116006834 14:39301669-39301691 TTTATAAAAGAGAATTTGAATGG - Intronic
1116021466 14:39467536-39467558 TCTAGAAAACAGCTTCAAAAGGG - Intergenic
1116229134 14:42193599-42193621 TCAGGAAAACTGAATTATAAAGG - Intergenic
1116259312 14:42602507-42602529 TCTAGAAAACAGCTGTAGGATGG - Intergenic
1116466519 14:45239707-45239729 TCTGGAAAACAGACTGAAAAAGG + Intronic
1116501289 14:45625841-45625863 TTATGATAACAGAATTAGAATGG - Intergenic
1116666682 14:47785330-47785352 CGTAGAAAACAGAATGAGGAGGG - Intergenic
1116930527 14:50686704-50686726 TCTAGAAAACAGTCTTTAAAAGG - Intergenic
1117346994 14:54842529-54842551 GCTAGGAAACAGAAGTAGAGAGG + Exonic
1117557332 14:56899402-56899424 CCTAGAAAACACATTTATAAAGG - Intergenic
1118122873 14:62865671-62865693 TTTGAAAAAAAGAATTAGAAAGG - Intronic
1119614138 14:76087309-76087331 ATTAGAAAACAGGATCAGAAAGG - Intergenic
1119986949 14:79148868-79148890 TCCACAAAAAAGAATAAGAAAGG - Intronic
1120007531 14:79376631-79376653 TTTTGAAAACAGAATTAAAAAGG - Intronic
1120486253 14:85117250-85117272 GCTAGCAAACAGAACAAGAAAGG + Intergenic
1120583486 14:86282653-86282675 TCAAGAAAACAGAGGAAGAAGGG - Intergenic
1121368377 14:93335018-93335040 TTTAAAAAACAAAATTAAAATGG + Intronic
1121474597 14:94185748-94185770 TCTAGAAAACTGATCTAGAGAGG - Intronic
1122006551 14:98709167-98709189 TCCAAAAAAGAGAATTAAAAGGG - Intergenic
1123053971 14:105560630-105560652 TGTAGAAAGGAGAATTCGAAGGG - Intergenic
1123078556 14:105681047-105681069 TGTAGAAAGGAGAATTCGAAGGG - Intergenic
1126037225 15:44558037-44558059 TTTACAAATCAGAATTAGACAGG + Intronic
1126288031 15:47038476-47038498 TCAAGAAAACATATTTTGAAAGG + Intergenic
1126885862 15:53149100-53149122 CCAAGAAAACAGAATCAGACTGG - Intergenic
1127019133 15:54726344-54726366 TCTAGAAAATAGACTCAGTAGGG - Intergenic
1127035348 15:54909783-54909805 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
1127052037 15:55094496-55094518 TGTAGAAAACTGAATAAGCAGGG - Intergenic
1127476944 15:59343646-59343668 TCTAGAAAATAGCTTCAGAAGGG - Intronic
1128032755 15:64496281-64496303 TCTAGAAAATAGAATGGTAACGG - Intronic
1128060669 15:64733665-64733687 TATGGAAACCAGAGTTAGAAAGG - Intergenic
1128084176 15:64874491-64874513 TCTACAAAAAAAAATTAGCAGGG + Intronic
1128530626 15:68443563-68443585 TCTAAAACACAGATATAGAAAGG - Intergenic
1128839403 15:70837500-70837522 TCTAGAAACCAGGATTTGAGGGG - Intronic
1130511976 15:84596958-84596980 TCTAGAAAACAGCCTCAGAAGGG + Intergenic
1130572314 15:85057708-85057730 TCAACAAAATAGAAATAGAAGGG - Intronic
1131004960 15:88970355-88970377 TATAGAAAAGAGAAAGAGAATGG - Intergenic
1131414497 15:92242018-92242040 TCTAGAAAGAAGAATTAGATTGG + Intergenic
1131743984 15:95425260-95425282 TCTAGAAAACAAAATAGGAAAGG - Intergenic
1131945077 15:97610547-97610569 TCTAGAAAAGAGCCTCAGAAGGG + Intergenic
1132236411 15:100225233-100225255 TCTTAAAAAAAGAATTAAAAAGG - Intronic
1133193300 16:4150496-4150518 TCTACAAAACACAAAAAGAAAGG - Intergenic
1133413087 16:5584559-5584581 TCCAGAAAACAGAAGCTGAAGGG - Intergenic
1133458872 16:5969085-5969107 AATATAAATCAGAATTAGAAAGG - Intergenic
1133943870 16:10332507-10332529 TCTAAAAAAAAAAATTAAAAAGG - Intronic
1134406850 16:13968396-13968418 TCTAGAAAACAGCTTCAAAAGGG - Intergenic
1135188479 16:20335148-20335170 TCTAGAAAAAAGTGTTAGAGAGG + Intronic
1135676798 16:24422217-24422239 TCACTAAAACAGATTTAGAAAGG - Intergenic
1136244405 16:28965423-28965445 TCTACAAAAAAAAATTAAAAAGG + Exonic
1136422529 16:30144430-30144452 ACTATAAAACAGAATTAGGCTGG + Intergenic
1137455233 16:48612878-48612900 TCTAGAATACAGAATTCATAAGG - Intronic
1138404327 16:56777227-56777249 TCTTGAAAACACATTTAAAATGG + Intronic
1138999107 16:62487390-62487412 TCCAGAAAACAGAAGCAGAGTGG + Intergenic
1139656933 16:68393711-68393733 ACAAGAAATTAGAATTAGAATGG - Intronic
1139849845 16:69944537-69944559 TCTAAAAAAAAGAAAAAGAAGGG + Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140298824 16:73736538-73736560 TCTGGCAAACAGAAATAAAAGGG + Intergenic
1140373676 16:74427959-74427981 TCTAAAAAAAAGAAAAAGAAGGG - Intergenic
1140838099 16:78814184-78814206 TCTAGAAGACAGAATTATTATGG - Intronic
1203105659 16_KI270728v1_random:1354625-1354647 TCTACAAGTCAGAATGAGAAGGG + Intergenic
1203127855 16_KI270728v1_random:1607743-1607765 TCTACAAGTCAGAATGAGAAGGG - Intergenic
1143951292 17:10634663-10634685 TCTGCAAAACAGAATGGGAATGG - Intronic
1146340722 17:32017637-32017659 TCTAAAAAAGAGAATTAGCCGGG + Intronic
1146859472 17:36284491-36284513 TCAAGTTAATAGAATTAGAAGGG + Intronic
1147089796 17:38088578-38088600 TCAAGTTAATAGAATTAGAAGGG + Intergenic
1147107415 17:38231942-38231964 TCAAGTTAATAGAATTAGAAGGG - Intergenic
1147129957 17:38401825-38401847 TCTAGAAAACCGCACTGGAAAGG - Exonic
1148174781 17:45554111-45554133 TCTAAAAAAGAGAATTAGACGGG - Intergenic
1148296590 17:46508916-46508938 TCTAAAAAAGAGAATTAGACGGG + Intergenic
1148387229 17:47243085-47243107 TCTATGAAATAGAGTTAGAAGGG - Intergenic
1148421984 17:47555907-47555929 TCAAGTTAATAGAATTAGAAGGG + Intronic
1148897749 17:50849831-50849853 TCTATACAACAGAATAATAATGG + Intergenic
1148998716 17:51735018-51735040 ATAAGAAAACAGCATTAGAAGGG + Intronic
1149312591 17:55409369-55409391 TCTAGAAAACAGAATTAGAAAGG - Intronic
1149979717 17:61300354-61300376 TTTAGAAAACTGAAGTTGAAGGG - Intronic
1149980669 17:61308757-61308779 GATAGAAAACAGACTTAGTATGG - Intronic
1150180543 17:63115221-63115243 TCCAGGAAACAGAATGAGATAGG + Intronic
1150405999 17:64901022-64901044 TCTAAAAAAGAGAATTAGATGGG - Intronic
1150785004 17:68154999-68155021 TCTAAAAAAGAGAATTAGCCGGG - Intergenic
1150891551 17:69156432-69156454 AAAAGAAAACAGAATTAGATTGG - Intronic
1151065587 17:71145837-71145859 CTTAGAAAAAACAATTAGAAAGG - Intergenic
1152175881 17:78786890-78786912 CCTAATAAAAAGAATTAGAAAGG + Intergenic
1153075149 18:1154633-1154655 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1153521296 18:5956561-5956583 TCTAGAAGAAAGAATTGGAGTGG - Intronic
1153610693 18:6881307-6881329 TCCAGAAAAGATACTTAGAAAGG - Intronic
1153858927 18:9179381-9179403 TCAGCAAACCAGAATTAGAAGGG - Intronic
1155443597 18:25886570-25886592 TCTAGAAAATAGACTCAAAAAGG + Intergenic
1155486387 18:26347424-26347446 TACAGAAAAGAGAAATAGAAAGG + Intronic
1156149343 18:34223923-34223945 TCTGTAAAACAGAATTTGATAGG - Intronic
1156509888 18:37627454-37627476 TGTGGAAAACTGAGTTAGAAGGG - Intergenic
1157767643 18:50312762-50312784 TCAAGAAGACAGAATGAGAGAGG - Intergenic
1157937148 18:51885400-51885422 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
1158213385 18:55074640-55074662 TTTAGAAAGCAAAATTGGAAAGG - Intergenic
1158431459 18:57391062-57391084 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
1158562979 18:58531033-58531055 TCTAGAAAAAAAAATTAGCCAGG + Intronic
1161884310 19:6981927-6981949 ATTATAAAAGAGAATTAGAATGG + Intergenic
1162679493 19:12329874-12329896 TCCAGAAAACAGAAGTAGGTAGG + Intronic
1163355899 19:16810600-16810622 TCTAGAAAAAAAAATTAGCCAGG + Intronic
1164456771 19:28414187-28414209 TAAAGAAAACAGAGTGAGAATGG - Intergenic
1165243611 19:34485012-34485034 TCTTGAAAACAAAATAAAAAAGG - Intronic
1166073362 19:40399096-40399118 CCGAGAGAACAGAATCAGAAGGG + Intronic
925183630 2:1832519-1832541 TTTAGGAAACAGAATGAGCAGGG - Intronic
925275892 2:2648079-2648101 TGTAGACAAGAGAATGAGAATGG - Intergenic
926457180 2:13081182-13081204 TCAGAAAAACAGAAGTAGAATGG - Intergenic
926478508 2:13358268-13358290 TCTAGAAAACAGCTTCAAAAGGG + Intergenic
926533072 2:14076117-14076139 TTTAGAAAAAAGACATAGAAGGG + Intergenic
926884773 2:17586805-17586827 TGGAGAAAACAGGATTGGAATGG + Intronic
926908317 2:17826487-17826509 TCTAAAAAAAAAAATTAGAAAGG - Intergenic
926970377 2:18461709-18461731 TGTAGAAAAAAGAATTAAAGAGG + Intergenic
927016892 2:18973451-18973473 ACTAGAAATCAGAACTTGAAAGG - Intergenic
928085963 2:28346578-28346600 TCTAGAACACAGGATTAGCCAGG + Intergenic
928396968 2:30949977-30949999 TCTAGATGGCAGAATCAGAATGG - Intronic
929027521 2:37619025-37619047 TCAAAATACCAGAATTAGAAAGG - Intergenic
929178348 2:39004647-39004669 AATAGAAACCAGAATGAGAAAGG + Intronic
929845731 2:45524123-45524145 TCAACAAACTAGAATTAGAAGGG + Intronic
929938193 2:46310303-46310325 CCTAGAATCCAGAATGAGAAAGG - Intronic
930399323 2:50863008-50863030 TCTAGAGAACAGAATGAGGCAGG + Intronic
930431522 2:51282729-51282751 TCTAGAATAGAGAATTTGATAGG - Intergenic
930884501 2:56309658-56309680 TTTAGAAAACAGTTTTAGGAAGG + Intronic
931001722 2:57792734-57792756 TCTAGAAAATAGACTCAAAAGGG - Intergenic
931161784 2:59701000-59701022 TCTAGAAAATAGCCTTAAAATGG - Intergenic
932091635 2:68811082-68811104 TGAAGAAAACAGAGTTTGAAAGG - Intronic
932203203 2:69851607-69851629 TCAAAAAAAAAGAATTAGCAGGG + Intronic
932874743 2:75439335-75439357 TCTGGAAAATAGCATTAGAGAGG + Intergenic
933122084 2:78551198-78551220 TCTAAAAATAAGAATTAGTAGGG + Intergenic
933230487 2:79801622-79801644 TCTTGAATACAAAATTAGAGTGG + Intronic
933910073 2:86932046-86932068 TTTAGGAAACAGACTTGGAAGGG + Intronic
934022654 2:87971363-87971385 TTTAGGAAACAGACTTGGAAGGG - Intergenic
934276644 2:91578079-91578101 TCTTAAAAACAGAATGAAAACGG - Intergenic
934723573 2:96600246-96600268 TGTAGAAAAAAAAATTTGAATGG + Intronic
934996930 2:98971908-98971930 TCTGGAATACAGTAATAGAAGGG - Intergenic
935663722 2:105491717-105491739 TCTATAAAACACAACAAGAAAGG - Intergenic
936413623 2:112283655-112283677 TTTAGGAAACAGACTTGGAAGGG + Intronic
936636587 2:114265766-114265788 CCTATAAAACAGAGTTAAAAGGG - Intergenic
936683279 2:114799334-114799356 AAGAGAAAACAGAATTAGTAGGG + Intronic
937552018 2:123106442-123106464 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
937655848 2:124375071-124375093 TCTAATGAACAGAAGTAGAATGG + Intronic
937678726 2:124621038-124621060 TTGATAAAACAGAATTATAAGGG + Intronic
938338519 2:130520135-130520157 TCTAAAAAACAAAATTAACAAGG + Intergenic
938351320 2:130600615-130600637 TCTAAAAAACAAAATTAACAAGG - Intergenic
938856995 2:135323709-135323731 TCAATAAACTAGAATTAGAAAGG + Intronic
939273753 2:139972464-139972486 TCTAGAAAACAGCCTTAAAAGGG + Intergenic
939285952 2:140129920-140129942 ACTAGAAAACATTATTAAAATGG + Intergenic
939604235 2:144233868-144233890 TTTAAAAAACAGACTTAAAAAGG + Intronic
939646290 2:144703176-144703198 TCTAGGAAACTGAAATAGGAGGG + Intergenic
939800081 2:146697576-146697598 TCCACAAAACAGAATCAGACAGG + Intergenic
939800592 2:146701935-146701957 TCTAGAAAATAGCCTCAGAAGGG + Intergenic
940020177 2:149147989-149148011 TCCTGAAAACAGAAGAAGAATGG - Intronic
940429613 2:153574491-153574513 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
940468826 2:154066227-154066249 TCTAGAAAATAGCCTCAGAAGGG + Intronic
940738644 2:157481656-157481678 TCTAGAAAATAGCCTTAAAAGGG + Intronic
940795567 2:158073338-158073360 TCTAGAAAACAGCCTCAAAAGGG + Intronic
941400332 2:165022420-165022442 TTTAGAGAACTGAATTAGAGTGG + Intergenic
941738439 2:169006361-169006383 TCTACAAACTAGGATTAGAAGGG + Intronic
941748770 2:169113813-169113835 TCTAGAAAAAGGAGTTAGAAAGG - Intergenic
941874698 2:170420815-170420837 TCTAAAAAGCAGAATTAGCATGG - Intronic
942883859 2:180897980-180898002 TCTACAAAAAAGAATTAGTAAGG + Intergenic
943839153 2:192555618-192555640 CCTAGAAAACAGATTTTAAAAGG - Intergenic
943915723 2:193629372-193629394 TCTAGAAAATAGCCTCAGAAGGG + Intergenic
944044883 2:195399252-195399274 ACTAGAAAACAGAATCAAAAAGG + Intergenic
944078811 2:195761334-195761356 TCTAGAAAATAGCCTTAAAAGGG + Intronic
944116150 2:196188481-196188503 ACCAGAAAGGAGAATTAGAATGG + Intergenic
944133088 2:196368617-196368639 TCTAGAAAACAGCCTCAAAAGGG - Intronic
944236506 2:197446029-197446051 TATAGAAAGCAAAATTAGCAAGG - Intergenic
944272616 2:197800727-197800749 TCAAGAAAACAGAATTTGTAGGG - Intergenic
944319227 2:198317314-198317336 TCTGGAAAATAGAATTCCAAGGG + Intronic
944616210 2:201463732-201463754 TCTAGAAAACAGCCTCAAAAGGG - Intronic
944751792 2:202716652-202716674 TCTAGAAAATAGCCTCAGAAGGG - Intronic
944854849 2:203758034-203758056 TCTAGAAAACAGCTTTGGAAGGG - Intergenic
945436599 2:209825765-209825787 TTTGGAAAACAGAATTGTAACGG - Intronic
945782328 2:214191081-214191103 TCTAGAATTCAGAAGAAGAATGG - Intronic
945782660 2:214195699-214195721 AGTAGAAAACAGAATCAGGAGGG + Intronic
946144708 2:217721060-217721082 TCTAAAAAACAGCAAAAGAAAGG + Intronic
946875050 2:224120623-224120645 TCTATAGAAGAGAATAAGAATGG + Intergenic
947240673 2:227990999-227991021 TCAGGAAAACAGAATTGAAAAGG - Exonic
947506233 2:230710517-230710539 TCTAGAAAAAAAAATTAGCCAGG - Intergenic
947930088 2:233957581-233957603 TATAGAATATAGAATTACAAAGG + Intronic
948958189 2:241311219-241311241 TCAATAAAAGAGAATCAGAACGG + Intronic
1168862446 20:1055498-1055520 ACTAGAAAACAGAAATAAATAGG + Intergenic
1168935778 20:1664407-1664429 TCCAGAAGACAGAATAAGTACGG + Intergenic
1169415193 20:5409999-5410021 TCTAAAACACAGAATAAGATTGG - Intergenic
1169643652 20:7783581-7783603 TCAGAAAAACAGAAATAGAAGGG - Intergenic
1169918814 20:10711385-10711407 TTTAAAAAAAAGAGTTAGAAAGG + Intergenic
1170174233 20:13450648-13450670 TCAAGAAACTAGAATTAGAATGG - Intronic
1171752987 20:29073205-29073227 TCTAGTTTAAAGAATTAGAATGG - Intergenic
1173207793 20:41008084-41008106 TCTAGGAAATAGACTTGGAATGG - Intergenic
1173633679 20:44535995-44536017 CATAGAAAACAAAAGTAGAATGG - Intronic
1174960627 20:55153252-55153274 GAAAGAAAACATAATTAGAAAGG + Intergenic
1175078778 20:56400138-56400160 ACAAGAAAACAGTATTGGAAGGG + Intronic
1175627139 20:60498911-60498933 TCAAGAAAAGAGATATAGAATGG - Intergenic
1175882244 20:62267082-62267104 TCTACAAAAAAGAATTAGCCGGG + Intronic
1176670326 21:9728137-9728159 TCTAGGAAACAGAAGAAAAATGG + Intergenic
1176876798 21:14137584-14137606 TCTAGAAAATAGCCTTAAAAGGG + Intronic
1177027613 21:15939286-15939308 TATAGAAATTAAAATTAGAATGG - Intergenic
1177121904 21:17147526-17147548 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1177266689 21:18794821-18794843 TTTAGAAACTAGAATTAGAAAGG - Intergenic
1177860392 21:26446014-26446036 TTTAGAAAACAGATATAGCAGGG - Intergenic
1177970224 21:27779513-27779535 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
1178362836 21:31963986-31964008 TGTAGAAGAGAGACTTAGAAAGG - Intronic
1178621426 21:34180335-34180357 CCAAGAAAACAGAATGCGAATGG + Intergenic
1178747502 21:35267222-35267244 TGTGCAAAACAGAATTTGAATGG - Intronic
1179118849 21:38523751-38523773 TTTCGAAAACATAATTTGAAAGG + Intronic
1180013155 21:45064670-45064692 TCTAGAAAACAAAAATAGGTGGG + Intergenic
1181753512 22:25006722-25006744 TCTAGAAAACAGAAAAGGCAAGG - Intronic
1183195681 22:36352006-36352028 ACTAGGAAACAGACTCAGAAAGG + Intronic
1183859066 22:40655984-40656006 TCTTCATAACAGAATGAGAATGG + Intergenic
1183892659 22:40942872-40942894 TCAGAAAAACAGAAGTAGAAGGG - Intergenic
1183979277 22:41530271-41530293 TCTATAAAAAACAATTAGCAGGG - Intronic
1184916829 22:47575070-47575092 TGTAGAACACAGAGCTAGAATGG + Intergenic
1185033453 22:48458195-48458217 TCCATAAAACAGAAGTAGATGGG + Intergenic
1185323621 22:50215076-50215098 TCTTAAAAACAAAATGAGAAGGG - Intronic
949108322 3:226885-226907 TTTTCAAAACAGAATAAGAAGGG + Intronic
949235525 3:1804736-1804758 TCTAGAAAATAGACTCAAAAAGG - Intergenic
949370485 3:3329264-3329286 ACTAGACAACAGAATGTGAATGG + Intergenic
949434083 3:4009321-4009343 GCTAGAAAATACAATTGGAAAGG + Intronic
949448328 3:4160198-4160220 TCTAGAAAATAGATTCAAAAGGG - Intronic
949475088 3:4436386-4436408 AATAGACAACAGAATTACAATGG + Intronic
949829073 3:8195467-8195489 CCTAGAAAACAGACTAAAAAGGG - Intergenic
950920774 3:16692355-16692377 TCTAGAATACAGAATCTAAAGGG - Intergenic
952020786 3:29016960-29016982 TCAAGAAAACTAAATTACAATGG - Intergenic
952566972 3:34670393-34670415 TGGATAAAGCAGAATTAGAATGG + Intergenic
952640203 3:35584537-35584559 TAATGAAAACAGAATTAGAAGGG - Intergenic
953124293 3:40076745-40076767 TCTAGAAAAAAGGGGTAGAAGGG + Intronic
953251148 3:41246740-41246762 CCTAGAAAACTGACTCAGAATGG - Exonic
954943065 3:54392882-54392904 TCTAGGAAAAAGGATTAGCAAGG + Intronic
955319657 3:57965162-57965184 TCTGTAAAACAGAATTCTAATGG + Intergenic
955569441 3:60288534-60288556 CCTAGAAAACAGAATGATTAAGG - Intronic
955648034 3:61161868-61161890 ACAAGGAGACAGAATTAGAATGG - Intronic
955680014 3:61490386-61490408 TCTAGAAACCAGAAAAAGTAAGG + Intergenic
955849739 3:63206828-63206850 TCTAGAATAGAGAATTTGATTGG - Intergenic
956439593 3:69266845-69266867 TCCAGAAAACTTAATTACAAAGG + Intronic
956465176 3:69513190-69513212 TCAAAAAACTAGAATTAGAAAGG + Intronic
958139820 3:89548008-89548030 TCTAGTAAATACAAATAGAAGGG - Intergenic
958144265 3:89603647-89603669 TCTATGAAACAAAATTAGACTGG + Intergenic
958817415 3:98930913-98930935 TCTTGAAAACAGAATACCAATGG - Intergenic
960050763 3:113237314-113237336 TCAAGAAAAGAGCATGAGAAGGG - Intronic
960198110 3:114795910-114795932 ACTAGAAAACAAAATTTTAAGGG - Intronic
960268278 3:115646719-115646741 TGGAGAAGACATAATTAGAATGG + Intronic
960353895 3:116627776-116627798 TCTAGAAAATAGTCTTAAAAGGG - Intronic
960840647 3:121955243-121955265 TCAGGAAAACAGGAATAGAAGGG - Intergenic
961100829 3:124197635-124197657 CCTTGGAAACAGCATTAGAATGG - Intronic
961964253 3:130886481-130886503 TCTAGAAAATAGCCTTAAAAGGG - Intronic
962006587 3:131355857-131355879 TCCAAAGAATAGAATTAGAAGGG - Intergenic
962077373 3:132096944-132096966 TGTTGAAACCAGTATTAGAAAGG + Intronic
962110511 3:132441155-132441177 CCTAGGAAAAAGAATTCGAATGG + Intronic
962194581 3:133350597-133350619 TCTAGAAAACAAATGGAGAAAGG + Intronic
962572540 3:136725258-136725280 ACTAGAAAACAAAATTATACGGG + Intronic
962868643 3:139469264-139469286 TCCAGAAAACACATTTAGAAAGG + Intronic
963179676 3:142340425-142340447 TCTAGAAAACAGCCTCAAAAGGG + Intronic
963360281 3:144263906-144263928 CCTGGAAAAAAAAATTAGAAAGG + Intergenic
963387120 3:144611431-144611453 TGTTGAAAAAAGCATTAGAAAGG + Intergenic
963439915 3:145326156-145326178 TCAAAGAAACAGAGTTAGAAAGG - Intergenic
964330812 3:155600392-155600414 TCCATAAAAGAGAATAAGAATGG + Intronic
964850352 3:161089296-161089318 TTTAGAGAACACAAATAGAATGG - Intronic
965025247 3:163293149-163293171 TAAAGAAAACAGAAATAAAAAGG + Intergenic
965040148 3:163497524-163497546 TCTAAATAACAGAATAAAAAGGG - Intergenic
965622879 3:170658329-170658351 TCTGCAAAAAATAATTAGAAGGG + Intronic
966349479 3:179015758-179015780 TCTAGAAAACAGGGTTAGAGAGG + Intergenic
966361911 3:179138870-179138892 TCAAATAAACACAATTAGAAAGG + Intergenic
967064648 3:185904044-185904066 AATAGAAAACAGAATCAGAGTGG - Intergenic
967490391 3:190083979-190084001 TTTAAAAAACATAATGAGAATGG - Intronic
967516776 3:190378912-190378934 ACTACAAGACATAATTAGAAAGG - Intronic
967547792 3:190752106-190752128 TGTAGAAAAGAAAATAAGAATGG - Intergenic
968021900 3:195399534-195399556 TCTGTAAAACAGAAATATAATGG - Intronic
968378418 4:65296-65318 CCTGGAAAACGGAAGTAGAAAGG - Intronic
968407095 4:350310-350332 CATAGAAAGCAGAAGTAGAAAGG - Intronic
968419044 4:467442-467464 CCTAGAAAACATAAGTAGAATGG + Intronic
970636433 4:18014810-18014832 TCTAGATAAGAGAATGTGAATGG - Intronic
971289812 4:25327351-25327373 TCAAAAAACCAGAAATAGAAGGG - Intronic
971478803 4:27096129-27096151 TATGGAAAACAGCATTTGAAAGG - Intergenic
972142981 4:35984495-35984517 TCTAGAAAATAGCCTTAAAAGGG + Intronic
972179191 4:36443044-36443066 TGTAGAAAAAGGAATTCGAAAGG - Intergenic
972522717 4:39875909-39875931 TCTAGAAAAAACAAGAAGAAAGG - Intronic
972808522 4:42557024-42557046 TGAAGAAAACAGAATTTGAAAGG + Intronic
973273897 4:48288827-48288849 ACCAGAAAACAGAATAGGAAAGG + Intergenic
973327273 4:48876485-48876507 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
974183080 4:58408704-58408726 TTTAGAAAGCAGAATTATCAAGG - Intergenic
974215391 4:58840734-58840756 TCTAGAAAACAGAACACAAAGGG + Intergenic
974337815 4:60573687-60573709 TGCAGAAGACTGAATTAGAATGG - Intergenic
975169654 4:71218489-71218511 TGTAGAAAGCAATATTAGAATGG + Intronic
975229147 4:71910393-71910415 TGTAAAAATAAGAATTAGAATGG - Intergenic
975331023 4:73113178-73113200 TCTAGAGTACAGAATTATAGGGG + Intronic
975339863 4:73227011-73227033 ACTGGAAAACAGAATTAAAGGGG - Intronic
975463384 4:74681946-74681968 TCTAGAAAATAGCCTTAAAAGGG - Intergenic
975652203 4:76604717-76604739 TATAGGAAACAGAAATAGCAGGG + Intronic
975687182 4:76928751-76928773 TCTTTAAAAAATAATTAGAATGG + Intergenic
975775011 4:77776988-77777010 TCTGGAAAACAGAAAAACAAAGG + Intronic
975789023 4:77927857-77927879 TCTAGAAAACAAGCTTAGATTGG - Intronic
976072422 4:81257230-81257252 TCTAGAAACTAGAATTCCAAGGG + Intergenic
976421577 4:84850821-84850843 ACTAGAAAACAGAAATGGGAGGG + Intronic
976495831 4:85728131-85728153 TCTGGAAAAAATAATTAGAATGG - Intronic
976579416 4:86718216-86718238 ACTGAAATACAGAATTAGAAAGG - Intronic
976747174 4:88414842-88414864 TCTAGATGACAGAATGAGATCGG - Intronic
976898604 4:90143457-90143479 GCTAGGAAACAGAAATACAATGG - Intronic
977192184 4:94014799-94014821 TCTATAAATTAGGATTAGAATGG - Intergenic
977440585 4:97061916-97061938 TTTAGAAAACAGCAAGAGAAAGG + Intergenic
978080780 4:104588814-104588836 TCATAAAAACAGAATTACAAGGG - Intergenic
978568354 4:110109438-110109460 TCTTGATGACAGAAATAGAAGGG - Intronic
979241766 4:118453396-118453418 GCTAGAAAACAGAATTCGTGGGG - Intergenic
979269547 4:118743927-118743949 TCTAAACAACAAAATTAAAATGG + Intronic
979360709 4:119761255-119761277 TATAGAAAACAGAATTACCAGGG - Intergenic
979838150 4:125400397-125400419 TCAAGAGAACAGTATTAAAAGGG - Intronic
980579105 4:134726083-134726105 TCTACAAAATAAAATTGGAAAGG + Intergenic
980782369 4:137508524-137508546 TTTAGAAACAAAAATTAGAAAGG + Intergenic
980939484 4:139260208-139260230 TCTAAAAAACAGAAGAAGGAAGG + Intergenic
980941908 4:139282732-139282754 TCTTGAAAACATTATTATAAAGG + Intronic
981154791 4:141422241-141422263 TCTAGAAAACAGTCTCAAAAGGG - Intergenic
981210206 4:142094457-142094479 TCTGAAAAACAGACTAAGAATGG + Intronic
981647181 4:147012656-147012678 CCCTGAAAACAGAATTAGAAAGG + Intergenic
981895815 4:149797419-149797441 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
982471437 4:155795754-155795776 TTTAGAAATCAGAACTAAAAAGG + Intronic
982815603 4:159879615-159879637 TCTAGATAGAAGAATTATAAAGG - Intergenic
982861498 4:160456600-160456622 TCCAGAAAACAGAAACAGAGGGG - Intergenic
983413963 4:167432117-167432139 TCTAGAAAATAGAAAAAGCAAGG + Intergenic
983594086 4:169446942-169446964 TCTAAAAAACAGACTCAGAAGGG + Intronic
984251735 4:177344163-177344185 TGTAGAAAACAGAATCAGGTCGG - Intronic
984256655 4:177397681-177397703 CCTAGAAAGCAGAATTTGAATGG - Intergenic
984392067 4:179148692-179148714 ACTAGAAAACCTAATTATAAAGG + Intergenic
985483811 5:137639-137661 TCCAGAAAACAGAAATGGGAGGG - Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
985938953 5:3118844-3118866 TCTTGAAACCAGAAGGAGAAGGG + Intergenic
986028729 5:3875177-3875199 TCTATAAAAGAGAAAAAGAAAGG + Intergenic
986086024 5:4448516-4448538 ATAAGAAAACAGAATTACAAAGG + Intergenic
986152978 5:5144772-5144794 TCCAGAAAACAGAGACAGAAGGG - Intronic
986159319 5:5211118-5211140 TCCAGAAAACAGAAGAGGAAGGG - Intronic
987107749 5:14657248-14657270 TTTAAAAAACAGAATTAGAGGGG - Intergenic
987459310 5:18188770-18188792 TCAAAATAACATAATTAGAAAGG - Intergenic
987953000 5:24700793-24700815 TCTAGAAAACAGACTCCAAAGGG - Intergenic
988112361 5:26839147-26839169 TTTATAAAAGAGAAGTAGAATGG + Intergenic
988368714 5:30338622-30338644 TCTAGAAAATATAATTTTAATGG - Intergenic
988608165 5:32700337-32700359 TCTAGAAAATAGCCTTAGAGGGG - Intronic
988973377 5:36491551-36491573 TCTACCAAACATAATTAGAAGGG - Intergenic
988984917 5:36608320-36608342 ATTAGAAAACACAACTAGAATGG - Exonic
989073846 5:37541634-37541656 TTTTTAAAAAAGAATTAGAATGG - Intronic
989083108 5:37647009-37647031 TCTAGAAAACAGCCTCAAAAGGG - Intronic
989390061 5:40890865-40890887 TCAACAAAATAGAAATAGAAGGG + Intergenic
990170365 5:53041333-53041355 TCTAGAATACAGGATGAGATTGG - Intronic
990214059 5:53511857-53511879 TCTAGAAAACAGCTTCAAAAGGG - Intergenic
990359043 5:54999151-54999173 TCGAGAAAACAGAATTGGTATGG + Intronic
991074663 5:62521438-62521460 TCAAGAATCAAGAATTAGAATGG - Intronic
991107307 5:62859657-62859679 TCTAGAAAATAGCCTTAAAAGGG - Intergenic
991453972 5:66782426-66782448 TCTAGTTAACAGAGTTAGAGTGG - Intronic
992011329 5:72530677-72530699 TCTAGAAAAGAGAGCCAGAAAGG - Intergenic
992013366 5:72552689-72552711 TCTAGAATACAAAATCAGAGTGG + Intergenic
992298256 5:75349322-75349344 AATAGAAAACAGAATTATAGAGG - Intronic
992587400 5:78254209-78254231 TCTAGAAAACAGCCTCAAAAGGG + Intronic
992880469 5:81104524-81104546 TATATAAAAGAGAATTGGAAAGG - Intronic
993057803 5:83002350-83002372 TTTAAAAAAATGAATTAGAAGGG - Intergenic
993582469 5:89679087-89679109 TCTAGAAAATAACATTAAAAGGG + Intergenic
994009285 5:94881378-94881400 TCTAGAAAATTTAATCAGAAGGG - Intronic
994028723 5:95115633-95115655 TCTAGAAAATAGCATCAAAAAGG + Intronic
994538558 5:101062956-101062978 TCCAGAAAACAGACTTAAAATGG - Intergenic
994981608 5:106881454-106881476 TATAAAAGACAGAATTAGGAAGG - Intergenic
995544925 5:113220624-113220646 ACTAGAATACAGAAATATAATGG + Intronic
995982189 5:118117743-118117765 TCTCGTAAATAGAATTTGAAGGG + Intergenic
996031187 5:118705558-118705580 TTTAGAAAAAAGGACTAGAAAGG - Intergenic
996270479 5:121598020-121598042 TCAAAAAGACAGTATTAGAATGG + Intergenic
996431752 5:123387970-123387992 TCTATAAAACTGTATTATAATGG - Intronic
998544771 5:143017546-143017568 TTTAGAAAAAAGAACTAAAAGGG - Intronic
999030873 5:148289825-148289847 TCTGGGAATCAGAATTAGGATGG + Intergenic
999126260 5:149248275-149248297 TCTAGAATACAGATTTGGAAAGG + Intronic
999218028 5:149952083-149952105 TCTAAAAAACAAAAAAAGAAAGG + Intergenic
1000200235 5:159002297-159002319 AATAGAAAGGAGAATTAGAAAGG - Intronic
1000570228 5:162902999-162903021 TCAAGAAAAATAAATTAGAAGGG + Intergenic
1000651156 5:163820788-163820810 TCTAGAAAACAGTCTCAAAAGGG - Intergenic
1000803090 5:165752759-165752781 GCTAGAAAACAAAACAAGAAAGG - Intergenic
1003024059 6:2537753-2537775 TTGAGAAAACAGAAGCAGAAAGG - Intergenic
1003025476 6:2551211-2551233 TCTGAAAAAAAGAATTAGGAGGG + Intergenic
1003093539 6:3124234-3124256 TTTAGAAATCAGAGTTAGATTGG + Intronic
1003276435 6:4657823-4657845 AGTAGAAAACAGAAATACAATGG + Intergenic
1003288077 6:4752452-4752474 TCGGGAAAGAAGAATTAGAATGG + Intronic
1003309250 6:4954451-4954473 TCTAGAACACAGAATCTAAAGGG + Intronic
1003839982 6:10109951-10109973 TGTACGAAACACAATTAGAATGG + Intronic
1005904129 6:30246082-30246104 CCTAGATAACAGAATTACTAAGG - Intergenic
1005994225 6:30921903-30921925 TCTGGGAAACAGAAAAAGAATGG - Exonic
1006018327 6:31101161-31101183 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1007001433 6:38317634-38317656 TCTAGAAAATAGCCTCAGAAGGG - Intronic
1007022112 6:38530984-38531006 TCTAGAAAACAGCCTCAAAAGGG + Intronic
1007220072 6:40271822-40271844 AGTAGAAAACAGACTGAGAAAGG - Intergenic
1008321904 6:50124695-50124717 ACAAGAAAAAAGATTTAGAATGG + Intergenic
1008324463 6:50161160-50161182 TATTTAAAACAAAATTAGAAAGG + Intergenic
1008754943 6:54783761-54783783 TCTAAAAAATAGAAATACAAAGG + Intergenic
1008822396 6:55649722-55649744 TCTAGAAAATAGTCTCAGAAGGG - Intergenic
1009352981 6:62706197-62706219 TCTAGAAAACAGTCTGAAAAGGG - Intergenic
1009371353 6:62906943-62906965 TCTAGAAAAGAGATTCAAAAGGG + Intergenic
1009428832 6:63543908-63543930 TCTTAAAAACAGAATAACAAGGG - Intronic
1009499860 6:64397655-64397677 TTTACAAAACAAAATTAGAAAGG - Intronic
1009510339 6:64543309-64543331 TTTAAAAAACAGTATTAAAATGG + Intronic
1009669761 6:66731771-66731793 TGGAGAAAACAGAATTAGATTGG - Intergenic
1009706466 6:67258666-67258688 TCTAGAAAACAGAATTTCCTTGG + Intergenic
1009799732 6:68520547-68520569 TCTAGAAAACAAAATCACAGGGG + Intergenic
1009978353 6:70698529-70698551 TCTAGAAAACAGTCCTAAAATGG - Intronic
1010843056 6:80671448-80671470 TCTAGAAAGTAGAAGTAAAAAGG + Intergenic
1011058324 6:83231602-83231624 TCTAGAAAATAGAAGTCCAAAGG - Intronic
1011177041 6:84575225-84575247 ACTAGAAAACAGAATTAAGCGGG - Intergenic
1011237601 6:85234582-85234604 TCTAGAAAACAGCCTTAAAAAGG + Intergenic
1012056971 6:94425671-94425693 TCTAGAAAACAGCTTTAAAAAGG - Intergenic
1012085699 6:94823761-94823783 TCTAGAAAATGAAATTAGGAAGG - Intergenic
1012714582 6:102652004-102652026 TCTAGAAAATAGACTCAAAAGGG + Intergenic
1012795487 6:103754692-103754714 TATATAAAAGAAAATTAGAAAGG + Intergenic
1012827509 6:104164337-104164359 TCTAGAAAATACAATAAAAAGGG + Intergenic
1012930608 6:105312353-105312375 TCTTAAAGACAGAATTAAAATGG + Intronic
1013292892 6:108733790-108733812 TCTAGAATAGAAAATTAGGAAGG - Intergenic
1013695843 6:112701630-112701652 TATAGAATACAGAGTTAGAAGGG + Intergenic
1014147769 6:118017721-118017743 CTTAGAAAACAAAATTAAAAGGG - Intronic
1014709624 6:124791490-124791512 CCTACAACACAGCATTAGAATGG + Intronic
1014988566 6:128044915-128044937 TCTAGATGACAGCATTAAAATGG - Intronic
1015273312 6:131359251-131359273 CCTAGAGAAAAGGATTAGAAGGG + Intergenic
1015486755 6:133780104-133780126 TCTAGAAATCAGAGTCAGATGGG + Intergenic
1015518791 6:134111483-134111505 TCTACAAAAAAGAATTAGCGAGG - Intergenic
1016088605 6:139946590-139946612 TCTTGAAAACAGTAAGAGAAGGG + Intergenic
1016457208 6:144243859-144243881 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
1016595723 6:145797660-145797682 TCTAGAAAAAAGAGTGAGAGAGG + Exonic
1017332371 6:153214793-153214815 TCTGAAAAACAGAATAATAAGGG - Intergenic
1017368108 6:153669069-153669091 TTCAGTAACCAGAATTAGAAGGG - Intergenic
1017579201 6:155842759-155842781 TCAAGAAACCAGGAATAGAAGGG + Intergenic
1018632329 6:165831828-165831850 CCAAGAAAACAGTATTAAAAAGG - Intronic
1019913973 7:4119453-4119475 TCTAAAAAAAATAATAAGAATGG + Intronic
1019933625 7:4240202-4240224 TCTGGAAAACAGACTTGAAAAGG + Intronic
1020048859 7:5067457-5067479 TCCAGAAAATAAAATTACAAAGG + Exonic
1020242491 7:6406651-6406673 TCTACAAAACAAAATTAGCTGGG - Intergenic
1020535531 7:9391547-9391569 TCTTTAAAGCAAAATTAGAAAGG - Intergenic
1021148706 7:17121979-17122001 TTTAAAAAATAGAATTTGAAAGG - Intergenic
1021211950 7:17864507-17864529 TCTAGAAAACAGTGTCATAAGGG + Intronic
1021863542 7:24931546-24931568 TCTAGAAGACAGAAAAAGCATGG + Intronic
1021953022 7:25793782-25793804 TCTAAAAAACAAAATTAGCTGGG + Intergenic
1022572041 7:31464032-31464054 TCTAAAAATAAGGATTAGAAAGG - Intergenic
1023290375 7:38662117-38662139 TCTTGAAAACAGAAGATGAATGG - Intergenic
1023632894 7:42181168-42181190 TCTAGAAAACAGACTTTCTAGGG + Intronic
1024307704 7:47942132-47942154 ACGAGAAAACAAAATTAGAGAGG - Intronic
1024324485 7:48098169-48098191 TATAGAAAACATAAGTACAAAGG - Intronic
1024418882 7:49139296-49139318 TTTAGAAAACCGAATAAAAAGGG + Intergenic
1026278859 7:68903935-68903957 CCCAGAAAAGAGAATTAGACTGG + Intergenic
1027480982 7:78696103-78696125 TCTACAAAACAAAAATAAAAAGG - Intronic
1028161205 7:87486624-87486646 TCTAGAAAATAGCATCAAAAGGG + Intergenic
1028339198 7:89696575-89696597 TCTAGAAAACAGCCTCAAAAGGG + Intergenic
1028872982 7:95788950-95788972 TCTGGAAGAAAGAATTAAAATGG - Intronic
1030476608 7:110042421-110042443 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1030799562 7:113832897-113832919 TCCAGAAAACAGAAATAGTTAGG - Intergenic
1031077743 7:117228999-117229021 TCACAAGAACAGAATTAGAATGG + Intronic
1031327591 7:120421495-120421517 TTTTGAAGACAGAATGAGAAAGG + Intronic
1031673773 7:124584515-124584537 TCTAGAAAAAAGATTTATTATGG - Intergenic
1031722789 7:125197745-125197767 TTTCGAAAACAGAAGTAGACTGG + Intergenic
1031834871 7:126670275-126670297 TCTAGAAAAGAGAGGTAAAAAGG + Intronic
1032686300 7:134237346-134237368 TCTTGAAAAAAGAATTAGCTGGG - Intronic
1032689610 7:134270473-134270495 TCAGGAAAATATAATTAGAAAGG - Intergenic
1032839283 7:135701644-135701666 TGTAGGAAACAGAGCTAGAAGGG + Intronic
1033400222 7:141015516-141015538 GCTTGAAAACAGATTTAGTATGG - Intergenic
1033775449 7:144604783-144604805 TCTAGAAACCAGAATGTTAATGG - Intronic
1033934101 7:146561496-146561518 TTTAGAAAAAAAAATTAGCAGGG + Intronic
1034218586 7:149427034-149427056 TGTAGAAAACAGAAATAAAAGGG + Intergenic
1034581617 7:152048768-152048790 TCTAGAAAACAGCCTCAAAAAGG - Intronic
1034861880 7:154602839-154602861 TCTATAAAAAAGAATTAAGATGG - Intronic
1034861988 7:154604359-154604381 TTTAAAGAAGAGAATTAGAAGGG - Intronic
1037037347 8:14183357-14183379 TCTTGAGAACAGAATAAAAATGG + Intronic
1037039628 8:14215187-14215209 ACTAGAAATCAATATTAGAAAGG + Intronic
1038871738 8:31502683-31502705 TCTAGAAAATAGACTCAAAATGG - Intergenic
1041115242 8:54529521-54529543 AGTAGAAAACAGATTTAAAAAGG - Intergenic
1041189479 8:55338993-55339015 TCTAGAAACCAGAACTATAAAGG + Intronic
1041305095 8:56449361-56449383 TCTAGAAATCAGACTAAAAAAGG + Intergenic
1041585454 8:59512207-59512229 ACTAGAACACAGATTGAGAATGG - Intergenic
1041768569 8:61447408-61447430 AATAGAAAAAAAAATTAGAATGG - Intronic
1041769736 8:61459696-61459718 TATGGAAAACAGAATTACAAGGG - Intronic
1042301964 8:67293567-67293589 TCTATAAAAAAGAATGAGGAAGG + Intronic
1042451625 8:68954375-68954397 TCTAGGAAACAGCATAAAAATGG + Intergenic
1042726704 8:71887067-71887089 TCTAGAAAACAGCCTCAAAAGGG - Intronic
1042910504 8:73821295-73821317 GTTAGAAAACAAAATCAGAATGG + Intronic
1042958124 8:74273672-74273694 TCTGGAAAACCTAATTGGAATGG + Intronic
1043100061 8:76032767-76032789 TTTAGAAAACAGCAATAGAGTGG + Intergenic
1043323162 8:79016473-79016495 TCTAGAAAATAGCCTTAAAAGGG - Intergenic
1043405757 8:79931236-79931258 TCTATAAAATAGAATTTGATAGG - Intronic
1045572593 8:103384732-103384754 TCTAGAAATGGGAAGTAGAAGGG + Intergenic
1045592278 8:103611918-103611940 TCTAGAAAATAGACTGAAAAGGG - Intronic
1045619775 8:103962202-103962224 TCTTGAAAACAGAAAATGAAAGG - Intronic
1045648633 8:104323167-104323189 TCTATAAAACAGACTAATAATGG + Intergenic
1046215417 8:111139878-111139900 TCTAGAAAATAGCCTTAAAATGG - Intergenic
1046261907 8:111779729-111779751 TCTAGAAGATAGAGTTAGAGAGG + Intergenic
1046389313 8:113547680-113547702 AATAGAAAACAGTATTAAAAAGG - Intergenic
1047659356 8:127015981-127016003 TATAAAAAACAGATTGAGAAAGG - Intergenic
1048593444 8:135842865-135842887 TCAAGGAAACAGGCTTAGAAAGG + Intergenic
1049631970 8:143663745-143663767 TCTAGAATACAGCATATGAAGGG - Intergenic
1050218007 9:3350367-3350389 TCTAAAATGCTGAATTAGAATGG + Intronic
1050270829 9:3942897-3942919 ACTAGAAAACAAAAGAAGAAAGG + Intronic
1050997164 9:12234894-12234916 TCTTGCAAACACAATTAAAAGGG + Intergenic
1051339518 9:16098621-16098643 CTTAGAACACAGAATTACAAGGG + Intergenic
1051549340 9:18311803-18311825 TCTACAACACAGTATTACAAAGG + Intergenic
1051643086 9:19241725-19241747 TTTAAAAAACATAAGTAGAACGG + Intronic
1051805461 9:20987822-20987844 TTTAAAAAACAAAATTAAAAGGG + Intronic
1052066863 9:24032782-24032804 TCTTGGAAACAGAATAAGGAGGG + Intergenic
1052502341 9:29307586-29307608 TATAGAATACAGCATTAGGAAGG - Intergenic
1052706656 9:32001420-32001442 TTTAGAATAGAAAATTAGAAAGG + Intergenic
1052791867 9:32882615-32882637 TCTAGAAACTATTATTAGAAAGG - Intergenic
1053493440 9:38529441-38529463 TCCAGAAAAAAGAAATACAAGGG + Intergenic
1053905308 9:42837371-42837393 TCAAGAAAACAGAAATGGCATGG + Intergenic
1054674666 9:67844121-67844143 TCAAGAAAACAGAAATGGCATGG + Intergenic
1054836815 9:69684011-69684033 TCAAGAAAACAGAATTTAAATGG + Intergenic
1054885789 9:70197023-70197045 TATAGCAGACAGATTTAGAATGG - Intronic
1055215766 9:73860217-73860239 TCCAGTGAACAGAAGTAGAAAGG + Intergenic
1055741696 9:79396764-79396786 TCTTGCAAACAGATTTTGAAGGG - Intergenic
1055886312 9:81068118-81068140 TCTAGAAAATAGCATTAAAAGGG - Intergenic
1056457004 9:86770136-86770158 TCAACAAAACAGACATAGAAGGG + Intergenic
1056557828 9:87704536-87704558 GCCAGAAAACAGAGTCAGAAGGG - Intronic
1057536878 9:95918751-95918773 TTTAAAAAACACAATGAGAATGG - Intronic
1057756240 9:97839271-97839293 TCTATAAAACAGATTTTGATAGG - Intergenic
1058304266 9:103417710-103417732 TCAAGAAAATACAAATAGAAAGG - Intergenic
1058560944 9:106228648-106228670 TCAAGATCACATAATTAGAATGG - Intergenic
1058838890 9:108886281-108886303 TCCAGAAAACAGAAGTGTAAAGG + Intronic
1059185015 9:112260322-112260344 TAAAGAAAACAAAAATAGAAGGG + Intronic
1059348379 9:113647618-113647640 TCTAGAAAAAATAATTAGTCAGG - Intergenic
1061814164 9:133183556-133183578 TCAATAAAAGAGAAATAGAAGGG + Intergenic
1062720424 9:138039344-138039366 TTTAAAAAACAGAATAAGCAAGG - Intronic
1203570820 Un_KI270744v1:128954-128976 CCTGGAAAACGGAAGTAGAAAGG + Intergenic
1186054237 X:5632043-5632065 TGTAGAAAACAGACTACGAAGGG - Intergenic
1186117511 X:6320650-6320672 TCTAGAAAACAGACTCATTATGG - Intergenic
1186573197 X:10737787-10737809 GCAAGAAAGCAGAAGTAGAAAGG + Intronic
1187315051 X:18185151-18185173 TCTAGAAAACAGCCTCAAAATGG + Intronic
1187654857 X:21460177-21460199 TTGATAAAACTGAATTAGAATGG - Intronic
1187736316 X:22307596-22307618 ACTACAAAACAGAAGTAGAGTGG - Intergenic
1187852876 X:23608447-23608469 TCTAGAAAACATGTTGAGAAAGG + Intergenic
1188161494 X:26809928-26809950 TCCAGAAAAAAATATTAGAATGG - Intergenic
1188192117 X:27183879-27183901 TCTAGAAAACAGCCTAAAAAGGG + Intergenic
1188742822 X:33807672-33807694 TCTAGAAAATAGCATTGAAATGG - Intergenic
1189061653 X:37759850-37759872 TCTAGTAGACCGAATTAAAATGG + Intronic
1189524461 X:41805053-41805075 ACTAAAAAACACAATTAAAATGG + Intronic
1189628361 X:42922971-42922993 TCTAGAAAATAGACTTGAAAGGG + Intergenic
1189640968 X:43069610-43069632 TCTAGAAAATAGACTCAAAAGGG + Intergenic
1189871817 X:45392271-45392293 TGTACAAAACATAAATAGAAAGG - Intergenic
1190530553 X:51370158-51370180 TCTAGAAAATAGCATCAAAAGGG + Intergenic
1190830759 X:54057213-54057235 TATAGTAAAAAGAATTAGATTGG + Intergenic
1191043708 X:56113583-56113605 TCTAGACAAAAAAATTAAAAAGG + Intergenic
1191822428 X:65326646-65326668 GCTAGAAGAAAGAATTTGAATGG + Intergenic
1191845534 X:65544886-65544908 TTGAGGAAACAGACTTAGAAGGG - Intergenic
1191972289 X:66829934-66829956 CCTAGAAAACAGAAAGAGATAGG + Intergenic
1191972328 X:66830610-66830632 CCTAGAAAACAGAAAGAGATAGG + Intergenic
1192045842 X:67673421-67673443 TCTAGAAAACAGCCTCAAAAGGG - Intronic
1192081068 X:68048489-68048511 TCTAGAAATCAGGACTGGAAAGG + Intronic
1192407202 X:70898493-70898515 TGGAGAAAACACCATTAGAAAGG + Intronic
1192714615 X:73626436-73626458 TCTAGAAAATAGTATCAAAAAGG - Intronic
1193087313 X:77458357-77458379 TCCAGAAAACAAAAGTAGAGTGG + Intergenic
1193260956 X:79405515-79405537 TCTAGAAAATAGACTCAAAAGGG + Intergenic
1193670445 X:84377752-84377774 TCTAGAAAATAGACTCAAAAGGG + Intronic
1193765527 X:85524494-85524516 TTTTGAAAACATAAATAGAATGG - Intergenic
1193821339 X:86169530-86169552 TCTAGAAAACAGCATTAAAAGGG - Intronic
1193981781 X:88189354-88189376 TCTAGAAAACAGCTTCAAAAGGG + Intergenic
1194042188 X:88955330-88955352 TCTAGTCAAAAGAACTAGAAGGG + Intergenic
1194204267 X:90993634-90993656 CCTAGAAAACAAAACTAAAATGG + Intergenic
1194236074 X:91384423-91384445 TCTAGAAAACAGCCTCAAAAAGG + Intergenic
1194715718 X:97285212-97285234 TCTAGAAAGCTGAATTTGAAAGG - Intronic
1194738962 X:97549447-97549469 TCTAGAAAAAAGATTAATAAAGG - Intronic
1194815370 X:98434328-98434350 TCTAGAAACCACAATTTGATTGG - Intergenic
1194889977 X:99366070-99366092 TCTAGAAAACAGCTTCAAAAGGG + Intergenic
1195046847 X:101062194-101062216 CCTAGAAACCAGAAGTATAAAGG - Intergenic
1195199895 X:102538597-102538619 TCTAGAAAATAGCATGAAAAGGG - Intergenic
1195559269 X:106264913-106264935 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
1195595627 X:106684850-106684872 TCTAGAAAATAGCATCAGAAGGG + Intergenic
1195620597 X:106950710-106950732 TCTACAAAACAGAACTGGAGAGG + Intronic
1196224391 X:113148681-113148703 AATAGAAAACAAAATTAGAAAGG + Intergenic
1196483787 X:116180994-116181016 ACTAGAAAACATAATTTTAAGGG + Intergenic
1196727006 X:118904772-118904794 TTTACAAATCATAATTAGAAAGG - Intergenic
1197052412 X:122076042-122076064 TCTAGAAAACAGCCTCAAAAGGG - Intergenic
1197113083 X:122799105-122799127 TCTAGAAAATAGCCTTAAAAGGG + Intergenic
1197508381 X:127337841-127337863 TCTACAAAAAAAAATTAAAATGG - Intergenic
1197602451 X:128546713-128546735 TCTAGAAAATAGCCTCAGAAGGG - Intergenic
1197692410 X:129516177-129516199 TCTTCAAAACATAATTATAATGG + Intronic
1197954495 X:131931383-131931405 TGTAGAAAAAAGACTTTGAAAGG - Intergenic
1198781640 X:140243673-140243695 TCTAGAGAACAGATTCAAAAGGG - Intergenic
1198887074 X:141351331-141351353 TCAGGAATACAGAATTAAAATGG - Intergenic
1198947346 X:142029517-142029539 TCTAGAAAACAGCTTCAAAAGGG - Intergenic
1199341787 X:146687547-146687569 TCTAGAAAATAGCATCAAAAGGG - Intergenic
1199362201 X:146934642-146934664 TCCACAAACCAGAAATAGAAAGG - Intergenic
1199826608 X:151506418-151506440 TCTATGAAACAGAATAAGAAGGG - Intergenic
1199859366 X:151786811-151786833 TACAGAAAACAGAATTAACAAGG + Intergenic
1199920093 X:152392009-152392031 TTTAGAAAACAGAAACAGAAGGG + Intronic
1200550106 Y:4569073-4569095 CCTAGAAAACAAAACTAAAATGG + Intergenic
1201001178 Y:9472225-9472247 CCTTGAATTCAGAATTAGAAAGG - Intronic
1201479830 Y:14427664-14427686 TCTAGAAAACAGACTCATTATGG + Intergenic
1201710164 Y:16982549-16982571 ACTAGAAAGCAGAAGGAGAAAGG - Intergenic