ID: 1149320050

View in Genome Browser
Species Human (GRCh38)
Location 17:55473196-55473218
Sequence TTAAGGATGAATTTCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149320050_1149320054 25 Left 1149320050 17:55473196-55473218 CCTTCATGGAAATTCATCCTTAA No data
Right 1149320054 17:55473244-55473266 TGCCATGCCACCAGCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149320050 Original CRISPR TTAAGGATGAATTTCCATGA AGG (reversed) Intergenic