ID: 1149320322

View in Genome Browser
Species Human (GRCh38)
Location 17:55475051-55475073
Sequence TGTCCTCTTAAACACTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149320322_1149320327 19 Left 1149320322 17:55475051-55475073 CCCCCACAGTGTTTAAGAGGACA No data
Right 1149320327 17:55475093-55475115 CTGCAGTCACCCCCACTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149320322 Original CRISPR TGTCCTCTTAAACACTGTGG GGG (reversed) Intergenic
No off target data available for this crispr