ID: 1149320327

View in Genome Browser
Species Human (GRCh38)
Location 17:55475093-55475115
Sequence CTGCAGTCACCCCCACTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149320322_1149320327 19 Left 1149320322 17:55475051-55475073 CCCCCACAGTGTTTAAGAGGACA No data
Right 1149320327 17:55475093-55475115 CTGCAGTCACCCCCACTACTTGG No data
1149320321_1149320327 20 Left 1149320321 17:55475050-55475072 CCCCCCACAGTGTTTAAGAGGAC No data
Right 1149320327 17:55475093-55475115 CTGCAGTCACCCCCACTACTTGG No data
1149320324_1149320327 17 Left 1149320324 17:55475053-55475075 CCCACAGTGTTTAAGAGGACAGG No data
Right 1149320327 17:55475093-55475115 CTGCAGTCACCCCCACTACTTGG No data
1149320323_1149320327 18 Left 1149320323 17:55475052-55475074 CCCCACAGTGTTTAAGAGGACAG No data
Right 1149320327 17:55475093-55475115 CTGCAGTCACCCCCACTACTTGG No data
1149320326_1149320327 16 Left 1149320326 17:55475054-55475076 CCACAGTGTTTAAGAGGACAGGC No data
Right 1149320327 17:55475093-55475115 CTGCAGTCACCCCCACTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149320327 Original CRISPR CTGCAGTCACCCCCACTACT TGG Intergenic
No off target data available for this crispr