ID: 1149332687

View in Genome Browser
Species Human (GRCh38)
Location 17:55602933-55602955
Sequence GAGTAGTATTTTTAAGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149332687_1149332689 7 Left 1149332687 17:55602933-55602955 CCCAATACTTAAAAATACTACTC No data
Right 1149332689 17:55602963-55602985 AGAAATTCTTTTTTTGCTGTTGG No data
1149332687_1149332690 23 Left 1149332687 17:55602933-55602955 CCCAATACTTAAAAATACTACTC No data
Right 1149332690 17:55602979-55603001 CTGTTGGTTGTTACTAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149332687 Original CRISPR GAGTAGTATTTTTAAGTATT GGG (reversed) Intergenic
No off target data available for this crispr