ID: 1149332690

View in Genome Browser
Species Human (GRCh38)
Location 17:55602979-55603001
Sequence CTGTTGGTTGTTACTAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149332685_1149332690 25 Left 1149332685 17:55602931-55602953 CCCCCAATACTTAAAAATACTAC No data
Right 1149332690 17:55602979-55603001 CTGTTGGTTGTTACTAGTGTTGG No data
1149332687_1149332690 23 Left 1149332687 17:55602933-55602955 CCCAATACTTAAAAATACTACTC No data
Right 1149332690 17:55602979-55603001 CTGTTGGTTGTTACTAGTGTTGG No data
1149332686_1149332690 24 Left 1149332686 17:55602932-55602954 CCCCAATACTTAAAAATACTACT No data
Right 1149332690 17:55602979-55603001 CTGTTGGTTGTTACTAGTGTTGG No data
1149332688_1149332690 22 Left 1149332688 17:55602934-55602956 CCAATACTTAAAAATACTACTCT No data
Right 1149332690 17:55602979-55603001 CTGTTGGTTGTTACTAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149332690 Original CRISPR CTGTTGGTTGTTACTAGTGT TGG Intergenic
No off target data available for this crispr